View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_high_13 (Length: 458)
Name: NF4647_high_13
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_high_13 |
 |  |
|
| [»] scaffold0394 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 113 - 447
Target Start/End: Original strand, 15058434 - 15058773
Alignment:
| Q |
113 |
tgtgacatttgagtaatcttttcatttgaaataacattgctctttaatttattgtgttcatatattgcgtttatcttcaacccgtgctgcacgagtgcac |
212 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15058434 |
tgtgacatttgagtaatcctttcgtttgaaatagcattgctctttaatttattgtgttcatatattgcgtttatcttcaacccgtgctgcacgagtgcac |
15058533 |
T |
 |
| Q |
213 |
agtctactaattataatgtcacacaaaataaagtgaaccctacnnnnnnnnnngtaaggaaaagtgaaccctacttataatatcatattgtttagtg--- |
309 |
Q |
| |
|
| |||| ||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
15058534 |
aatctagtaattataatgtcacacaaaataaagtaaaccctac---tttttttgtaaggaaaagtgaaccctacttataatatcatattgtttactgttt |
15058630 |
T |
 |
| Q |
310 |
--------ataatacaatgcaatgcgcatcattaacaccaacacttggcctagaatttctcaattatattattctattaagcaccggcgtctggtggtac |
401 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| || |
|
|
| T |
15058631 |
agtaatatataatacaatgcaatgcgcatcattaacaccaacacatggcctagaatttctcaattatattattctactaagcaccggcgtctggtggcac |
15058730 |
T |
 |
| Q |
402 |
aaccaccgtatcgtatgtccttttgtttgtcttggaacacaggttc |
447 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
15058731 |
aaccaccgtatcgtatgtccttttg---gtcttggaacacgggttc |
15058773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394 (Bit Score: 73; Significance: 4e-33; HSPs: 3)
Name: scaffold0394
Description:
Target: scaffold0394; HSP #1
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 220 - 345
Target Start/End: Complemental strand, 5783 - 5664
Alignment:
| Q |
220 |
taattataatgtcacacaaaataaagtgaaccctacnnnnnnnnnngtaaggaaaagtgaaccctacttataatatcatattgtttagtgataatacaat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
5783 |
taattataatgtcacacaaaataaagtgaaccctacttttttt---gtaaggaaaagtgaaccctacttataatatcatattgttta---atgatacaat |
5690 |
T |
 |
| Q |
320 |
gcaatgcgcatcattaacaccaacac |
345 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
5689 |
gcaatgcgcatcattaacaccaacac |
5664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 349 - 387
Target Start/End: Complemental strand, 5629 - 5591
Alignment:
| Q |
349 |
gcctagaatttctcaattatattattctattaagcaccg |
387 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5629 |
gcctagaatttctcaattatattattctattaagcaccg |
5591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0394; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 405 - 441
Target Start/End: Complemental strand, 5595 - 5559
Alignment:
| Q |
405 |
caccgtatcgtatgtccttttgtttgtcttggaacac |
441 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |
|
|
| T |
5595 |
caccgtatcgtatgtccttttgttggtcttggaacac |
5559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University