View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_high_21 (Length: 326)
Name: NF4647_high_21
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_high_21 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 178 - 308
Target Start/End: Original strand, 7052512 - 7052642
Alignment:
| Q |
178 |
tatgtcccatttgggattgattattgnnnnnnnatatttcattgcattctcaaatatattttgatcgtatacgacataaagcatcgatgttgtttttgtc |
277 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7052512 |
tatgtcccatttgggattgattattgtttttttatatttcattgcattctcaaatatattttgatcgtatacgacataaaacatcgatgttgtttttgtc |
7052611 |
T |
|
| Q |
278 |
ttcaaagtttgataaattctggggtaacttt |
308 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |
|
|
| T |
7052612 |
ttcaaagtttgataaattatggggtaacttt |
7052642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 43 - 144
Target Start/End: Original strand, 7051630 - 7051731
Alignment:
| Q |
43 |
aaaagttgcgacggatttcacacaaaatacataatgttggttgacattttatgttttatagagttccatttaaatccatgcgaattattgagatggattt |
142 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7051630 |
aaaagttgcgacggatttcacacaaaatacataatgttgcttgttattttatgttttatagagttccatttaaatccatgcgaattattgagatggattt |
7051729 |
T |
|
| Q |
143 |
ta |
144 |
Q |
| |
|
|| |
|
|
| T |
7051730 |
ta |
7051731 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University