View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_high_23 (Length: 265)
Name: NF4647_high_23
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_high_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 13 - 247
Target Start/End: Original strand, 48879427 - 48879661
Alignment:
| Q |
13 |
cagaccgggtagtcatgagggcaacagctggaaccgtcgtcgcagcaagttgcagactcaatagggcagcatccccaagcaaagcagaagtttccatact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879427 |
cagaccgggtagtcatgagggcaacagctggaaccgtcatcgcagcaagttgcagactcaatagggcagcatccccaagcaaagcagaagtttccatact |
48879526 |
T |
 |
| Q |
113 |
caaaaaggcaacaacatgtggttccagctgagcaagagtagtattcatcacatacagttgaaggctgaacaggtgatggaggtgaaggaccaggatttgg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48879527 |
caaaaaggcaacaacatgtggttccagctgagcaagagtagtattcatcacatacagttgaaggctgaacaggtgatggaggtgaaggaccaggatttgg |
48879626 |
T |
 |
| Q |
213 |
tgggttctgacccttcttgataggataggatgcct |
247 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
48879627 |
tgggttctgacccttcttgataggatatgatgcct |
48879661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University