View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_low_30 (Length: 241)
Name: NF4647_low_30
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_low_30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 38935013 - 38935239
Alignment:
| Q |
15 |
cagcacgtgtgcatgataaagctacgttcatggcaaacactattgtttcagctaatttccctgttggaggtggaagcctttggtccacaacatccttcac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38935013 |
cagcacgtgtgcatgataaagctacgttcatggcaaacactattgtttcagctaatttccctgttggaggtggaagcctttggtccacaacatccttcac |
38935112 |
T |
|
| Q |
115 |
aagcacttccattgatgtcaaagacttatttgaatttagggtgcccaagaattctccagggtgttttcccatcattatctctaacaccaccactccaaaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38935113 |
aagcacttccattgatgtcaaagacttatttgaatttagggtgcccaagaattctccagggtgttttcccatcattatctccaacaccaccactccaaaa |
38935212 |
T |
|
| Q |
215 |
ctatacacatcacacttttctgtcacc |
241 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
38935213 |
ctatacacatcacacttttctgtcacc |
38935239 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University