View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_low_31 (Length: 239)
Name: NF4647_low_31
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 28 - 223
Target Start/End: Original strand, 9252582 - 9252777
Alignment:
| Q |
28 |
tttagtgatgtttagtaagcaagggtgtggaaactgaccaccaagtcgaatgggctaattacccagttatacgaaaccaaatatgattcatcaagtaatt |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9252582 |
tttagtgatgtttagtaagcaagggtgtggaaactcaccaccaagtcgaatgggctaattacccagttatacgaaaccaaatatgattcatcaagtaatt |
9252681 |
T |
 |
| Q |
128 |
ttttggagcttcaatttggttatagttctagttaaacttggtgtagtatttggacgacgagatttttattgagagatggttacaagtggaataatg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9252682 |
ttttggagcttcaatttggttatagttctagttaaacttggtgtagtatttggacgacgagatttttattgagagatggttacaagtggaataatg |
9252777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University