View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_low_32 (Length: 239)
Name: NF4647_low_32
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_low_32 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 5300731 - 5300950
Alignment:
| Q |
1 |
cttgaggtatgtgttgattgtagtccctctaacttgnnnnnnnnatgtgccccttcaattttaagttattccaattaagacccttaaactattttaaaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5300731 |
cttgaggtatgtgttgattgtagtccctctaacttgttttttatatgtgccccttcaattttaagttatttcaattaagacccttaaactattttaaaat |
5300830 |
T |
|
| Q |
101 |
ttattcacttaaaactcaccaattaaat-aaacctatggaatcatatgagtgctgtggcgtagttgttgtccacacagtataagttggcatgaagctgaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5300831 |
ttattcacttaaaactcaccaattaaataaaatctatggaatcatatgggtgttgtggcgtagttgttgtccacacagtataaggtggcatgaagctgaa |
5300930 |
T |
|
| Q |
200 |
tagcatgacatttggcttct |
219 |
Q |
| |
|
| |||||||||||||||||| |
|
|
| T |
5300931 |
ttgcatgacatttggcttct |
5300950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University