View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_low_33 (Length: 238)
Name: NF4647_low_33
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 182
Target Start/End: Complemental strand, 30050061 - 30049880
Alignment:
| Q |
1 |
caaccggggacaaatgctgtcatccatgtttagtgttttgttcagtgcattgcttcttagtttcctgagtttaaaagatgaaaattatggttactgcttc |
100 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
30050061 |
caaccggggataaatgctgtcatccatgtttagtgttttgttcagtgcattgcttcttagtttcctgaatttaaaagatgaaaattatggttactgcttc |
30049962 |
T |
|
| Q |
101 |
caatgtttgtagtttatacttatcttttacattgaagtttgtgacttacacttgctgtatttgaggactgctgaatagtttt |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30049961 |
caatgtttgtagtttatacttatcttttacattgaagtttgtgacttacacttgctgtatttgaggactgctgaatagtttt |
30049880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 134 - 223
Target Start/End: Complemental strand, 30033723 - 30033634
Alignment:
| Q |
134 |
gaagtttgtgacttacacttgctgtatttgaggactgctgaatagttttgatggaagaggaccttcaagtgctccaaactccataatact |
223 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||| | |||||||||||||||||| |
|
|
| T |
30033723 |
gaagtttacgacttacacttgctgtatttgaggactgctgaagagttttgatgggagaggaccttcaagagatccaaactccataatact |
30033634 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 177 - 219
Target Start/End: Complemental strand, 30045121 - 30045079
Alignment:
| Q |
177 |
agttttgatggaagaggaccttcaagtgctccaaactccataa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30045121 |
agttttgatggaagaggaccttcaagtgctccaaactccataa |
30045079 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 6 - 69
Target Start/End: Complemental strand, 30033863 - 30033800
Alignment:
| Q |
6 |
ggggacaaatgctgtcatccatgtttagtgttttgttcagtgcattgcttcttagtttcctgag |
69 |
Q |
| |
|
||||||||||||||||| |||||| |||||| ||||||| ||||||| ||||||||||||||| |
|
|
| T |
30033863 |
ggggacaaatgctgtcacccatgtctagtgtattgttcaatgcattgtgtcttagtttcctgag |
30033800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University