View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_low_34 (Length: 237)
Name: NF4647_low_34
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_low_34 |
 |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0022 (1 HSPs) |
 |  |  |
|
| [»] scaffold0056 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0295 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 107; Significance: 9e-54; HSPs: 20)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 1 - 131
Target Start/End: Complemental strand, 30003858 - 30003728
Alignment:
| Q |
1 |
gttagttatggtggaccaaatttaaagagtgtatatggatagatttctcattttgatcgttttactccctccgtttcaaaatacttgtctaagtcaacca |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| ||||||| || |
|
|
| T |
30003858 |
gttagttatggtggactaaatttaaagagtgtatatggatagatttctcattttgatcattttactccctccgtttcaaaatacatgtcaaagtcaatca |
30003759 |
T |
 |
| Q |
101 |
cttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |
|
|
| T |
30003758 |
cttcacatatgtcaatgtacaattttgaccg |
30003728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 40771772 - 40771840
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
40771772 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatggcaatgctcaattttgaccg |
40771840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 11641067 - 11641133
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
11641067 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
11641133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 36757486 - 36757552
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
36757486 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
36757552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 36399360 - 36399295
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
36399360 |
tactccctccgtttcaaaatacatgtccaagtcaacaacttcacatatgccaatgcacaattttga |
36399295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 40977488 - 40977554
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
40977488 |
tactccatccgtttcaaaatacatgtccaagtcaaccacttcacacatgccaatgcacaattttgac |
40977554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 30701980 - 30701915
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
30701980 |
tactccctccgttttaaaatacatgtccaagtcaacaaattcacatatgtcaatgcacaattttga |
30701915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 52024288 - 52024223
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
52024288 |
tactccctccgtttcaaaatacatgtccaagtcaacaacttcacatataccaatgcacaattttga |
52024223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 9342645 - 9342713
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| |||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
9342645 |
tactccatccgtttcaaaatatatgttcaagtcaaccacttcacatatgccaatgcacaattttgaccg |
9342713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 127
Target Start/End: Original strand, 16120439 - 16120503
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttg |
127 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
16120439 |
tactccctccgtttcaaaatacatgttcaagtcaaccacttcacatatgccaatgcacaactttg |
16120503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 25171415 - 25171347
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||| ||||||||||| |||| |||||||||||||| |
|
|
| T |
25171415 |
tactccatccgtttcaaaatacatgtcaaagtcaaccccttcacatatgccaatacacaattttgaccg |
25171347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 6766631 - 6766565
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||| ||||||||||||||| ||| |||||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
6766631 |
tactccatccgtttcaaaatacatgtttaagtcaaccacttcacatatgctaatgcataattttgac |
6766565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 17306216 - 17306150
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||| ||||||||||||||||| |||| |||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
17306216 |
tacttcctccgtttcaaaatacatgtccaagtcaactacttcacatatgccaatgcataattttgac |
17306150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 70 - 131
Target Start/End: Original strand, 15912345 - 15912406
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||| | |||| ||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
15912345 |
tccgtttcaaaatgcatgtccaagtcaaccacttcacatatgccaatgcacaattttaaccg |
15912406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 42788542 - 42788611
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||| ||| ||||||| ||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
42788542 |
ttactccctccattttaaaatacatgttcaagacaactacttcacatatgtcaatgcacaattttgaccg |
42788611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 73 - 129
Target Start/End: Original strand, 6402420 - 6402476
Alignment:
| Q |
73 |
gtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
6402420 |
gtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
6402476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 72 - 131
Target Start/End: Complemental strand, 27292893 - 27292834
Alignment:
| Q |
72 |
cgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||| |||| ||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
27292893 |
cgtttcaaaatacatgtcaaagtcaaccacttcacatatgctaatgcataattttgaccg |
27292834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 64 - 131
Target Start/End: Original strand, 42367297 - 42367364
Alignment:
| Q |
64 |
actccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||| |||||||||||||||| | || ||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
42367297 |
actctctccgtttcaaaatacatatccaagtcaatcacttcacatatgctaatgcacaattttgaccg |
42367364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 42735165 - 42735233
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||| |||| |||| ||| ||||| ||||||||||||| |
|
|
| T |
42735165 |
tactccctccatttcaaaatacatgtccaagtcaatcactacacacatgccaatgtacaattttgaccg |
42735233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 70 - 129
Target Start/End: Complemental strand, 48375257 - 48375199
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||| ||||||||| |||||||||||| || |||| |||||||||||| |
|
|
| T |
48375257 |
tccgtttcaaaatacatgtctaagtgaaccacttcacacatcccaat-cacaattttgac |
48375199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 61; Significance: 3e-26; HSPs: 27)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 14237542 - 14237474
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14237542 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
14237474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 623438 - 623372
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
623438 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgtcaatgcataattttgac |
623372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 36641858 - 36641924
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
36641858 |
tactccctccgtttcaaaatacatgtctaagtcaaccacttcacatatgccaatgcataattttgac |
36641924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 24524347 - 24524281
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||| |||||||| |||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24524347 |
tactccctccgttccaaaatacatgtccaagtcaaccatttcacatatgtcaatgcacaattttgac |
24524281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 40494646 - 40494580
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
40494646 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
40494580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 65 - 131
Target Start/End: Original strand, 42587250 - 42587316
Alignment:
| Q |
65 |
ctccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
42587250 |
ctccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcacaatttttaccg |
42587316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 18044688 - 18044619
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaa-gtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| ||| ||| ||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18044688 |
tactccctccgtttcaaaatacatgtataaagtcaaccacttcacatatgccaatgcacaattttgaccg |
18044619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 61 - 129
Target Start/End: Original strand, 38958759 - 38958827
Alignment:
| Q |
61 |
tttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||| |||||||||| || ||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38958759 |
tttactcccttcgtttcaaaacacatgttcaagtcaaccacttcacatatgtcaatgcacaattttgac |
38958827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 5878578 - 5878512
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
5878578 |
tactccctccgtttcaaaatgcatgtccaagtcaaccacttcaaacatgtcaatgcacaattttgac |
5878512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 64 - 129
Target Start/End: Original strand, 3100492 - 3100557
Alignment:
| Q |
64 |
actccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||| |||| || |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
3100492 |
actccctccgtttcaaaatacatgtccaaatcaatcacttcagatatgtcaatgcacaattttgac |
3100557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 74 - 128
Target Start/End: Original strand, 22489285 - 22489339
Alignment:
| Q |
74 |
tttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
||||||||||| ||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22489285 |
tttcaaaatacatgtttaagtcaaccacttaacatatgtcaatgcacaattttga |
22489339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 132279 - 132211
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||| ||||||| |||| |||||||| |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
132279 |
tactccctccgttttaaaatacatgtccaagtcaactacttcacacatgccaatgtacaattttgaccg |
132211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 13216720 - 13216787
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||| |||| ||| ||| ||||| |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
13216720 |
ttactccctctgttttaaattacatgtcttagtcaaccacttcacataggtcgatgcacaattttgac |
13216787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 617045 - 616979
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| |||| | ||||| ||||||| ||||||||| |
|
|
| T |
617045 |
tactccctccgtttcaaaatacatgtccaagtcaacaacttaaaatatgacaatgcaaaattttgac |
616979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 73 - 126
Target Start/End: Complemental strand, 8394598 - 8394545
Alignment:
| Q |
73 |
gtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaatttt |
126 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
8394598 |
gtttcaaaatacatgtccaagtcaaccacttcatatatgtcaatgtacaatttt |
8394545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 69 - 130
Target Start/End: Complemental strand, 38957426 - 38957365
Alignment:
| Q |
69 |
ctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
||||||||||||||| |||| ||||||| ||||||||| ||| |||||||||||||||||| |
|
|
| T |
38957426 |
ctccgtttcaaaatatatgtccaagtcaagcacttcacacatgccaatgcacaattttgacc |
38957365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 2766048 - 2766116
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||| ||||||||||||||||| |||| || ||| ||| |||||| |||||||||||||||||| |||| |
|
|
| T |
2766048 |
tacttcctccgtttcaaaatacatgtccaaatcagccatttcacacatgtcaatgcacaattttaaccg |
2766116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 4270108 - 4270176
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||| |||| ||||||| |||| || | ||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
4270108 |
tactccctctgttttaaaatacatgtccaaattaaccacttcacatatgttaatgcataattttgaccg |
4270176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 11638041 - 11637976
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||| ||||||||||||||||| | ||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
11638041 |
tacttcctccgtttcaaaatacata---aagtcaaccacttcatatatgtcaatgaacaattttgaccg |
11637976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 24288022 - 24287954
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||| |||||||||||||||| |||| | ||||| |||||||| ||| |||||||||| |||||||| |
|
|
| T |
24288022 |
tactctctccgtttcaaaatacatgtcgcaatcaacgacttcacacatgccaatgcacaactttgaccg |
24287954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 62 - 130
Target Start/End: Original strand, 33700072 - 33700140
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||| |||| ||| |||| ||||| ||||||| |
|
|
| T |
33700072 |
ttactccctccgttccaaaatacatgtcgcagtcaaccactgcacacatgccaatacacaactttgacc |
33700140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 41264072 - 41264004
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||| ||||||||||| |||| ||||||| |||||||||||| |||| || ||||||||||| |
|
|
| T |
41264072 |
tactccatccatttcaaaatacatgtccaagtcaatcacttcacatataccaatacataattttgaccg |
41264004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 4461471 - 4461537
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||| |||||||||| |||| |||||| |||||||| ||| | ||||||||||||||| |
|
|
| T |
4461471 |
tactccctccgcttcaaaatacatgtcgttgtcaactacttcacacatgacgatgcacaattttgac |
4461537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 98 - 131
Target Start/End: Complemental strand, 32998676 - 32998643
Alignment:
| Q |
98 |
ccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
32998676 |
ccacttcacatatgccaatgcacaattttgaccg |
32998643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 98 - 130
Target Start/End: Complemental strand, 33921718 - 33921686
Alignment:
| Q |
98 |
ccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
33921718 |
ccacttcacatatgtcaatgtacaattttgacc |
33921686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 74 - 130
Target Start/End: Complemental strand, 35403768 - 35403712
Alignment:
| Q |
74 |
tttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
||||||||||| |||| |||| || || |||||||||||||| | |||||||||||| |
|
|
| T |
35403768 |
tttcaaaatacatgtccaagttaatcatttcacatatgtcaacgtacaattttgacc |
35403712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 130
Target Start/End: Original strand, 40204721 - 40204789
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
||||||||||||||||||| || |||| ||||||||||| |||| || |||| ||||||||||||| |
|
|
| T |
40204721 |
ttactccctccgtttcaaagtatatgtcacagtcaaccactgcacacgtgccaatacacaattttgacc |
40204789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 67769 - 67838
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
67769 |
ttactccatccgtttcaaaatacatgtctaagtcaaccacttcacatatgccaatgcacaattttgaccg |
67838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 58; Significance: 2e-24; HSPs: 27)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 19433357 - 19433426
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19433357 |
ttactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcacaattttgaccg |
19433426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 25296579 - 25296647
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25296579 |
tactccctccgtttcaaaatacatgtataagtcaaccacttcacacatgtcaatgcacaattttgaccg |
25296647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 2760729 - 2760796
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
2760729 |
ttactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgtcaatgcataattttgac |
2760796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 29830605 - 29830540
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
29830605 |
tactccctccgtttcaaaatacatgtctaagtgaaccacttcacatatgtcaatgcataattttga |
29830540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 26170249 - 26170181
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
26170249 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgacaatgctcaattttgaccg |
26170181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 35686669 - 35686601
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||| | |||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35686669 |
tactccctccgtttcaaaatgcatgtccaagtcaaccacttcacatatgccaatgcacaattttgaccg |
35686601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 61 - 131
Target Start/End: Original strand, 17446632 - 17446701
Alignment:
| Q |
61 |
tttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||| |||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17446632 |
tttactccc-ccgtttcaaaatacatgtccaagtcaactacttcacatatgtcaatgcacaattttgaccg |
17446701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 38416650 - 38416716
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
38416650 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
38416716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 44232077 - 44232143
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
44232077 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgacaatgcataattttgac |
44232143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 17610543 - 17610474
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
17610543 |
ttactccctccgtttcaaaatatatgttcaagtcaaccacttcacatatgccaatgcacaattttgaccg |
17610474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 68 - 131
Target Start/End: Original strand, 50620491 - 50620554
Alignment:
| Q |
68 |
cctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
50620491 |
cctccgttttaaaatagatgtctaagtcaaccacttcacatatgtcaatgcacaattttaaccg |
50620554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 55209573 - 55209640
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
55209573 |
ttactccctccgtttcaaaatacatgtccaagtcaaccactttacatatgccaatgcataattttgac |
55209640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 45292094 - 45292028
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||| |||||||||||| ||||||| ||||||||| |
|
|
| T |
45292094 |
tactccctccgtttcaaaatacatgtccaagtcaactacttcacatatgccaatgcataattttgac |
45292028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 63 - 128
Target Start/End: Original strand, 9029449 - 9029514
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||||||||||| ||||||| ||| |||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
9029449 |
tactccctccgttttaaaatacatgtttaagtcaatcacttcacatatgccaatgcacaattttga |
9029514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 4467520 - 4467588
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| | ||| |||||||| |||||||||| |
|
|
| T |
4467520 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcaaacatgccaatgcacgattttgaccg |
4467588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 12625513 - 12625445
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
12625513 |
tactccctccgtttcaaaatacatgttcaagtcaaccactccacatatgctaatgcacaattttgaccg |
12625445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 54330690 - 54330758
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||| |||||||||||||||| |||| ||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
54330690 |
tacttcctccgtttcaaaatagatgtccaagtcaatcacttcacatatgtcaatgcacaattttaaccg |
54330758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 43967986 - 43967919
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
43967986 |
ttactccatccgtttcaaaatacatgttcaagtcaaccacttcacatatgccaatgcataattttgac |
43967919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 66 - 128
Target Start/End: Complemental strand, 26125967 - 26125905
Alignment:
| Q |
66 |
tccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
||||||||||||||||||| ||| ||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
26125967 |
tccctccgtttcaaaatacatgttcaagtcaatcacttcacatatggcaatgcacaattttga |
26125905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 62 - 128
Target Start/End: Complemental strand, 38721600 - 38721534
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
||||||| |||||||||||| || ||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38721600 |
ttactccttccgtttcaaaagacatgttcaagtcaaccacttcacatatgccaatgcacaattttga |
38721534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 131
Target Start/End: Complemental strand, 55801051 - 55800993
Alignment:
| Q |
73 |
gtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||| |||| ||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
55801051 |
gtttcaaaatacatgtcaaagtcaaccactttatatatgtcaatgcacaattttgaccg |
55800993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 72 - 130
Target Start/End: Original strand, 12240186 - 12240244
Alignment:
| Q |
72 |
cgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |||| ||||||||||||| |
|
|
| T |
12240186 |
cgtttcaaaatatatgtcaaagtcaaccacttcacatatgccaatacacaattttgacc |
12240244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 35380894 - 35380960
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||| ||||||||||||||||| |||| ||||||||||||||||||||| |||| | ||||||||| |
|
|
| T |
35380894 |
tacttcctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatatataattttgac |
35380960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 47386286 - 47386354
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||||| |||||||| ||| ||||| | ||||||||||| |
|
|
| T |
47386286 |
tactccatccgtttcaaaatacatgtccaagtcaactacttcacacatgccaatgtataattttgaccg |
47386354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 70 - 131
Target Start/End: Complemental strand, 25918455 - 25918397
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||| ||| ||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
25918455 |
tccgtttcaaaatacatgtttaagtcaac---ttcacatatgtcaatgtacaattttgaccg |
25918397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 68 - 129
Target Start/End: Complemental strand, 5428833 - 5428772
Alignment:
| Q |
68 |
cctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||| |||||||||||| ||| |||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
5428833 |
cctctgtttcaaaatacatgtaacagtcaaccacttcacacatgtcaatgtacaattttgac |
5428772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 55192086 - 55192018
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||| ||||||||||||||| |||| || || | ||||||||||||| |||| |||||||||||||| |
|
|
| T |
55192086 |
tactcactccgtttcaaaatatatgtccaaatcgatcacttcacatatgccaatccacaattttgaccg |
55192018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 57; Significance: 6e-24; HSPs: 21)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 6910596 - 6910528
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6910596 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcacaattttgaccg |
6910528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 28690510 - 28690442
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28690510 |
tactccctccttttcaaaatacatgtccaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
28690442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 32221095 - 32221027
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32221095 |
tactccctccgttttaaaatacatgtcaaagtcaaccacttcatatatgtcaatgcacaattttgaccg |
32221027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 33416062 - 33415995
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||| |||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33416062 |
ttacttcctccgtttcaaaatagatgtccaagtcaaccacttcacatatgtcaatgcacaattttgac |
33415995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 20765458 - 20765392
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
20765458 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
20765392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 27010474 - 27010540
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
27010474 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
27010540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 42761483 - 42761549
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
42761483 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
42761549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 70 - 130
Target Start/End: Complemental strand, 21797811 - 21797751
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
21797811 |
tccgtttcaaaatacatgtctaagtcaaccacttcacatatgttaatgcataattttgacc |
21797751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 65 - 129
Target Start/End: Original strand, 42490198 - 42490262
Alignment:
| Q |
65 |
ctccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
42490198 |
ctccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
42490262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 43467742 - 43467810
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| || | ||||||||||||||||||||||||| |
|
|
| T |
43467742 |
tactccatccgtttcaaaatacatgtctaagtcaaccattttatatatgtcaatgcacaattttgaccg |
43467810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 13499335 - 13499401
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
13499335 |
tactccctccatttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
13499401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 27334731 - 27334797
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
27334731 |
tactccctccgtttcaaaatacatgttcaagtcaaccacttcacatatgccaatgcataattttgac |
27334797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 39866141 - 39866207
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
39866141 |
tactccctccgtttcaaaatacatgttcaagtcaaccacttcacatatgccaatgcataattttgac |
39866207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 64 - 131
Target Start/End: Complemental strand, 36227806 - 36227739
Alignment:
| Q |
64 |
actccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||| ||||||||| ||| ||||||||||||||||||| |
|
|
| T |
36227806 |
actccctccgtttcaaaatatatgtccaagtcaatcacttcacacatgccaatgcacaattttgaccg |
36227739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 21005555 - 21005489
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
21005555 |
tactccatccgtttcaaaatacatgtccaagtcaaccatttcacatatgccaatgcataattttgac |
21005489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 73 - 131
Target Start/End: Complemental strand, 38138077 - 38138019
Alignment:
| Q |
73 |
gtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
38138077 |
gtttcaaaatacatgtccaagtcaaccacttcacacatgccaatgcacaattttgaccg |
38138019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 19824560 - 19824492
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||| ||||||| |||||||| |||| ||||||||||||||| ||||||||| |||||||||| |||| |
|
|
| T |
19824560 |
tactctctccgttacaaaatacatgtccaagtcaaccacttcaaatatgtcaacgcacaattttaaccg |
19824492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 73 - 131
Target Start/End: Complemental strand, 42345650 - 42345592
Alignment:
| Q |
73 |
gtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||| |||| |||||||||| |||||||||||| ||| ||||||||||||| |
|
|
| T |
42345650 |
gtttcaaaatacatgtccaagtcaaccatttcacatatgtcgatgtacaattttgaccg |
42345592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 44562047 - 44561978
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||||||||||||||| ||| |||| ||||| |||||||| |
|
|
| T |
44562047 |
ttactccctccgattcaaaatacatgtcgcagtcaaccacttcacacatgccaattcacaactttgaccg |
44561978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 30214068 - 30213999
Alignment:
| Q |
63 |
tactccctccgtttcaaaatact---tgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||| ||||||||||| | |||| ||||||||||||||||||||| | ||||| ||||||||| |
|
|
| T |
30214068 |
tactccctctgtttcaaaataatagatgtccaagtcaaccacttcacatatgccgatgcataattttgac |
30213999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 76 - 131
Target Start/End: Original strand, 43181369 - 43181424
Alignment:
| Q |
76 |
tcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||| |||| || ||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
43181369 |
tcaaaatacatgtccaaatcaaccacttctcacatgtcaatgcataattttgaccg |
43181424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 55; Significance: 1e-22; HSPs: 33)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 61 - 131
Target Start/End: Complemental strand, 16778769 - 16778699
Alignment:
| Q |
61 |
tttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16778769 |
tttacttcctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcacaattttgaccg |
16778699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 28061515 - 28061581
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
28061515 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
28061581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 36623570 - 36623504
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
36623570 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
36623504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 46103370 - 46103436
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
46103370 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
46103436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 47156289 - 47156223
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
47156289 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
47156223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 3851337 - 3851268
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3851337 |
ttactccatccgtttcaaaatgtatgtctaagtcaaccacttcacatatgccaatgcacaattttgaccg |
3851268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 70 - 131
Target Start/End: Original strand, 11502587 - 11502648
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11502587 |
tccgtttcaaaatacatgtcaaagtcaaccacttcacatatgccaatgcacaattttgaccg |
11502648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 20885366 - 20885297
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||| ||||||||||| |||| ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
20885366 |
ttactccctccatttcaaaatacatgtccaagtcaaccacttcacacatgccaatgcacaattttgaccg |
20885297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 64 - 129
Target Start/End: Complemental strand, 48602697 - 48602632
Alignment:
| Q |
64 |
actccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
48602697 |
actccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
48602632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 25566548 - 25566616
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||| |||||||||| ||||| ||||||||||||| |
|
|
| T |
25566548 |
tactccctccgtttcaaaatacatgtccaagtcaaccatttcacatatgccaatgtacaattttgaccg |
25566616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 32431358 - 32431426
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
32431358 |
tactccatccgtttcaaaatacatgtccaagtcaaccactttacatatgccaatgcacaattttgaccg |
32431426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 41898250 - 41898184
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||||||||||||| ||||||| ||||||||| |
|
|
| T |
41898250 |
tactccctccgtttcaaaatacatgtccaagtcaatcacttcacatatgccaatgcataattttgac |
41898184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 67 - 131
Target Start/End: Original strand, 39129930 - 39129994
Alignment:
| Q |
67 |
ccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| |||||||||||| |||||||| |||||||||| |
|
|
| T |
39129930 |
ccctccgtttcaaaatacatgtcaaagtcaactacttcacatatgccaatgcacgattttgaccg |
39129994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 42877648 - 42877580
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||| ||| |||||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
42877648 |
tactctctctgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcacagttttgaccg |
42877580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 66 - 129
Target Start/End: Original strand, 23707426 - 23707489
Alignment:
| Q |
66 |
tccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
23707426 |
tccctctgttttaaaatacttgttcaagtcaaccacttcacatatgtcaatgcataattttgac |
23707489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 38851847 - 38851913
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||| ||||||||||||| |||| ||||||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
38851847 |
tactccctgcgtttcaaaatacatgtccaagtcaaccactttacatatgccaatgcataattttgac |
38851913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 6175088 - 6175020
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||| |||| ||||||||||| | | |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
6175088 |
tactcactccatttcaaaatacatattcaagtcaactacttcacatatgtcaatgcacaattttgaccg |
6175020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 46321152 - 46321220
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||| |||||||||||| |||| || |||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
46321152 |
tactccctctgtttcaaaatacatgtccaaatcaaccactttacatatgctaatgcacaattttgaccg |
46321220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 67 - 129
Target Start/End: Original strand, 40089922 - 40089984
Alignment:
| Q |
67 |
ccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||| |||| |||||||| | |||||||||| ||||||| ||||||||| |
|
|
| T |
40089922 |
ccctccgtttcaaaatacatgtccaagtcaactatttcacatatgccaatgcataattttgac |
40089984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 42890344 - 42890410
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||| |||||||||||||| |||| ||||||||||||| ||||||| ||||||| ||||||||| |
|
|
| T |
42890344 |
tactccttccgtttcaaaatatatgtccaagtcaaccactttacatatgccaatgcataattttgac |
42890410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 63 - 126
Target Start/End: Complemental strand, 21380006 - 21379943
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaatttt |
126 |
Q |
| |
|
|||||| ||||||| ||||||| |||||| |||||||||||||||||||||||| | |||||| |
|
|
| T |
21380006 |
tactccatccgtttgaaaatacacgtctaaatcaaccacttcacatatgtcaatgtataatttt |
21379943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 72 - 131
Target Start/End: Complemental strand, 30342326 - 30342267
Alignment:
| Q |
72 |
cgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||| |||| || |||||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
30342326 |
cgtttcaaaatacatgtccaaatcaaccacttcacacatgtcaatgtacaattttaaccg |
30342267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 65 - 129
Target Start/End: Complemental strand, 7439163 - 7439099
Alignment:
| Q |
65 |
ctccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||| ||||||| ||||||| |||| | ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
7439163 |
ctccttccgttttaaaatacatgtccaggtcaatcacttcacatataccaatgcacaattttgac |
7439099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 36585924 - 36585856
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| | ||||||||||||| |||| ||||||| ||||||||||||| ||| || ||||||||||| |
|
|
| T |
36585924 |
tactccattcgtttcaaaatacatgtccaagtcaagcacttcacatatgccaacacataattttgaccg |
36585856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 40256317 - 40256250
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||| |||||||||||| ||| |||||||| |||||||| ||| |||||||||||||||||| |
|
|
| T |
40256317 |
tactccctc-gtttcaaaatacatgttcaagtcaactacttcacacatgcaaatgcacaattttgaccg |
40256250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 63 - 130
Target Start/End: Complemental strand, 36516101 - 36516034
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
||||||||||||||| |||||| |||| ||||||||||||| || ||| |||| ||||| ||||||| |
|
|
| T |
36516101 |
tactccctccgtttctaaatacatgtcagagtcaaccacttcgcacatgccaatacacaactttgacc |
36516034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 117
Target Start/End: Complemental strand, 8684079 - 8684025
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatg |
117 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||| |||| ||||||||| ||||||||| |
|
|
| T |
8684079 |
tactccatccgtttcaaaatacatgtttaaatcaatcacttcacacatgtcaatg |
8684025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 35117387 - 35117321
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||| |||| |||||| |||| ||||||| ||||| ||||||||||||| | ||||||||| |
|
|
| T |
35117387 |
tactccctcagttttaaaatatatgtcaaagtcaatcactttacatatgtcaatgtataattttgac |
35117321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 73 - 123
Target Start/End: Complemental strand, 41950840 - 41950790
Alignment:
| Q |
73 |
gtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaat |
123 |
Q |
| |
|
|||| ||||||| | || |||||||| |||||||||||||||||||||||| |
|
|
| T |
41950840 |
gtttgaaaatacatatccaagtcaactacttcacatatgtcaatgcacaat |
41950790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 70 - 131
Target Start/End: Complemental strand, 44732266 - 44732206
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||| ||| |||| ||||||| ||||||||| || |||||| ||||||||||||| |
|
|
| T |
44732266 |
tccgtttcaaa-tacatgtccaagtcaatcacttcacacatatcaatgtacaattttgaccg |
44732206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 72 - 128
Target Start/End: Complemental strand, 7169376 - 7169320
Alignment:
| Q |
72 |
cgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||||||||| |||| ||||||| | |||| |||||||||||||||||||||| |
|
|
| T |
7169376 |
cgtttcaaaatatatgtcacagtcaactatttcatatatgtcaatgcacaattttga |
7169320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 60 - 128
Target Start/End: Original strand, 7457742 - 7457810
Alignment:
| Q |
60 |
ttttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
||||||||| || ||||||||||| | | || ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
7457742 |
ttttactccatctatttcaaaatacatattcaattcaaccacttcacatatgttaatacacaattttga |
7457810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 26161861 - 26161793
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||| |||| ||||| |||| |||||| ||||||||| |||||||||||||| |||||||| |
|
|
| T |
26161861 |
tactccctctgttttaaaatttgtgtcgcagtcaatcacttcacacatgtcaatgcacaactttgaccg |
26161793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 54; Significance: 4e-22; HSPs: 1)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 100646 - 100715
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
100646 |
ttactccctccgtttcaaaatacatgtccaagtcaacaacttcacatatgccaatgcacaattttgaccg |
100715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 53; Significance: 2e-21; HSPs: 20)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 18668688 - 18668756
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| ||||| ||||||||||||||||||| |
|
|
| T |
18668688 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcatatatgccaatgcacaattttgaccg |
18668756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 20226298 - 20226366
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
20226298 |
tactccctccgtttcaaaatacatgtcaaagtcaaccacttcacatatgccaatgcacaatttttaccg |
20226366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 20437017 - 20437085
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
20437017 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgtcaatgcataattttaaccg |
20437085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 22120282 - 22120350
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
22120282 |
tactccctccgtttcaaaatacatgtcaaagtcaaccacttcacatatgccaatgcacaatttttaccg |
22120350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 24623941 - 24624007
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
24623941 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
24624007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 22055035 - 22054966
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
22055035 |
ttactccctccgtttcaaaatacatgtccaagtcaatcacttcacatatgccaatgcataattttgaccg |
22054966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 6563488 - 6563422
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||| ||||||| | ||||||| |
|
|
| T |
6563488 |
tactccctccgtttcaaaatatatgtctaagtcaaccacttcacatatgccaatgcatatttttgac |
6563422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 19087958 - 19088024
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||| ||||||| ||||||||| |
|
|
| T |
19087958 |
tactccctccgtttcaaaatacatgtccaagtcaaccgcttcacatatgccaatgcataattttgac |
19088024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 21540628 - 21540697
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||| || |||||||||||| |||| ||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
21540628 |
ttactccttctgtttcaaaatacatgtccaagtcaaccacttcacacatgccaatgcacaattttgaccg |
21540697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 32672078 - 32672013
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
32672078 |
tactccttccgtttcaaaatacatgtccaagtcaacaacttcacatatgccaatgcacaattttga |
32672013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 62 - 125
Target Start/End: Complemental strand, 1041087 - 1041024
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattt |
125 |
Q |
| |
|
||||||| ||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
1041087 |
ttactccatccgtttcaaaatacacgtccaagtcaaccactttacatatgtcaatgcacaattt |
1041024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 24955395 - 24955462
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||| |||||||||| |||| |||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
24955395 |
ttactccctccgcttcaaaatacatgtccaagtcaacaatttcacatatatcaatgcacaattttgac |
24955462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 32414679 - 32414745
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||| ||||||||||||||||| ||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32414679 |
tacttcctccgtttcaaaatacatgttcaagtcaaccacttcacatatgccaatgcataattttgac |
32414745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 4148193 - 4148128
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||| |||| |||||||||||| |||| ||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
4148193 |
tacttcctcagtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttga |
4148128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 17213792 - 17213860
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| || |||||||||||| |||||||||||||| |||||||||| |||||||||||||| |||| |
|
|
| T |
17213792 |
tactccatctgtttcaaaatacacgtctaagtcaaccatttcacatatgccaatgcacaattttaaccg |
17213860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 12226237 - 12226172
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||| ||||||| ||||||| |||| ||||||||||||||||| ||| |||| ||||||||||| |
|
|
| T |
12226237 |
tactccatccgttttaaaatacatgtccaagtcaaccacttcacacatgccaatacacaattttga |
12226172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 60 - 130
Target Start/End: Complemental strand, 29694148 - 29694078
Alignment:
| Q |
60 |
ttttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
|||||||| ||| |||||||||||| |||| |||||| |||||||||||||||| |||| || ||||||| |
|
|
| T |
29694148 |
ttttactctctctgtttcaaaatacatgtcgtagtcaatcacttcacatatgtcagtgcataactttgacc |
29694078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 131
Target Start/End: Complemental strand, 28477986 - 28477947
Alignment:
| Q |
92 |
agtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
28477986 |
agtcaatcacttcacatatgtcaatgcacaactttgaccg |
28477947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 92 - 131
Target Start/End: Complemental strand, 29790439 - 29790400
Alignment:
| Q |
92 |
agtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
29790439 |
agtcaatcacttcacatatgtcaatgcacaactttgaccg |
29790400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 17257651 - 17257717
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||| | ||||||||||||| ||| |||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
17257651 |
tactccattcgtttcaaaatacaagtccaagtcaaccacttcacgtatgccaatgttcaattttgac |
17257717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 52; Significance: 6e-21; HSPs: 17)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 978340 - 978273
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
978340 |
ttactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
978273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 62 - 129
Target Start/End: Complemental strand, 33387482 - 33387415
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
33387482 |
ttactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
33387415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 9502627 - 9502693
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
9502627 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
9502693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 14634157 - 14634223
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
14634157 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
14634223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 63 - 131
Target Start/End: Original strand, 18094081 - 18094149
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||| |||||||||||||| |||| |||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
18094081 |
tactccccccgtttcaaaatacatgtccaagtcaaccatttcacatatgacaatgcacaattttgaccg |
18094149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 27109950 - 27109882
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||||||| ||||||| ||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27109950 |
tactccatccgttttaaaatacatgttcaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
27109882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 63 - 130
Target Start/End: Original strand, 12446867 - 12446934
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgacc |
130 |
Q |
| |
|
|||||||||| |||||||||| |||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12446867 |
tactccctccatttcaaaatatatgtccaagtcaatcacttcacatatgtcaatgcacaattttgacc |
12446934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 69 - 131
Target Start/End: Complemental strand, 11251370 - 11251308
Alignment:
| Q |
69 |
ctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||| |||||||| |||| ||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
11251370 |
ctccgttgcaaaatacatgtccaagtcaaccacttcacatatgccaatgcacaattttgaccg |
11251308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 65 - 129
Target Start/End: Original strand, 30354872 - 30354936
Alignment:
| Q |
65 |
ctccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||| ||||||||||||||| | | ||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
30354872 |
ctccttccgtttcaaaatacatatttaagtcaacaacttcacatatgtcaatgcacaattttgac |
30354936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 63 - 126
Target Start/End: Original strand, 33587469 - 33587532
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaatttt |
126 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||| ||| |||||||||||||| |
|
|
| T |
33587469 |
tactccctccgttttaaaatacatgtctaagtcaatcacttcacacatgccaatgcacaatttt |
33587532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 125
Target Start/End: Original strand, 8086031 - 8086093
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattt |
125 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
8086031 |
tactccctccgtttcaaaatacatgttcaagtcaaccacttcacatatgccaatgcataattt |
8086093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 40156462 - 40156392
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttca--catatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| || |||||||||||| |||| ||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
40156462 |
tactccatctgtttcaaaatacatgtccaagtcaaccacttaattcatatgtcaatgcacaattttgaccg |
40156392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 67 - 131
Target Start/End: Complemental strand, 7224423 - 7224359
Alignment:
| Q |
67 |
ccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||| || |||| | ||||| ||||||||||||| |||||||||||||| |||| |
|
|
| T |
7224423 |
ccctccgtttcaaaacacatgtccaggtcaatcacttcacatatgccaatgcacaatttttaccg |
7224359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 70 - 129
Target Start/End: Complemental strand, 34112212 - 34112153
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||| ||||||| ||| ||||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
34112212 |
tccgttttaaaatacatgttcaagtcaaccacttcacacatgtcaatgtacaattttgac |
34112153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 38916252 - 38916321
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||||||||||||||| |||| | |||||||||||||| ||| |||||||||| ||||||| |
|
|
| T |
38916252 |
ttactccctccgtttcaaaatatatgtcgcaatcaaccacttcacacatgccaatgcacaaccttgaccg |
38916321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 25889525 - 25889457
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||||| | ||||||||||||||| ||||||||| |||| |
|
|
| T |
25889525 |
tactccatccgtttcaaaatacatgttcaagtcaatctgttcacatatgtcaatacacaattttaaccg |
25889457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 11785726 - 11785792
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||| ||| ||||| ||||||| |||| |||| ||||| || | ||||||||||||||||||||||| |
|
|
| T |
11785726 |
tacttccttcgttttaaaatacatgtccaagttaaccattttaaatatgtcaatgcacaattttgac |
11785792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 20)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 5405258 - 5405192
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
5405258 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
5405192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Complemental strand, 7608311 - 7608245
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
7608311 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
7608245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 19141066 - 19141132
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
19141066 |
tactccctccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcataattttgac |
19141132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 62 - 131
Target Start/End: Complemental strand, 44365420 - 44365351
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
44365420 |
ttactccctccgtttcaaaatacatgtccaagtcaatcacttcacatatgccaatgcataattttgaccg |
44365351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 8042022 - 8042088
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
8042022 |
tactccctccgtttcaaaatatatgtccaagtcaaccacttcacatatgtcaatgtataattttgac |
8042088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 11841592 - 11841661
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||||| ||||||||||||| |||||| ||||||||||| |
|
|
| T |
11841592 |
ttactccctccgtttcaaaatacatgtccaagtcaatcacttcacatatgctaatgcataattttgaccg |
11841661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 33607634 - 33607569
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
33607634 |
tactccatccgtttcaaaatacatgtccaagttaactacttcacatatgtcaatgcacaattttga |
33607569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 2182960 - 2183026
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||||||||||||||||||| ||| || ||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
2182960 |
tactccctccgtttcaaaatacatgttcaaatcaacaacttcacatatgccaatgcacaattttgac |
2183026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 62 - 128
Target Start/End: Original strand, 13125144 - 13125210
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
||||||| ||||||||||||||| |||| ||||||| ||||||||||||| ||||| |||||||||| |
|
|
| T |
13125144 |
ttactccatccgtttcaaaatacatgtccaagtcaatcacttcacatatgccaatgtacaattttga |
13125210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 62 - 131
Target Start/End: Original strand, 9172145 - 9172214
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||| |||| ||||||||||| |||| ||||||||||||||||| ||| ||||| ||||||||||||| |
|
|
| T |
9172145 |
ttactcactccatttcaaaatacatgtccaagtcaaccacttcacacatgccaatgtacaattttgaccg |
9172214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 74 - 129
Target Start/End: Complemental strand, 36072425 - 36072370
Alignment:
| Q |
74 |
tttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||| |||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
36072425 |
tttcaaaatacatgtccaagtcaatcacttcacatatgacaatgcacaattttgac |
36072370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 62 - 129
Target Start/End: Original strand, 36177579 - 36177646
Alignment:
| Q |
62 |
ttactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||| ||||||||||||||| |||| |||||||||||||||| || ||||||||||| |||||| |
|
|
| T |
36177579 |
ttactccatccgtttcaaaatacatgtcacagtcaaccacttcacacatatcaatgcacaactttgac |
36177646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 72 - 131
Target Start/End: Original strand, 36719333 - 36719392
Alignment:
| Q |
72 |
cgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
||||| ||||||| ||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36719333 |
cgttttaaaatacatgttcaggtcaaccacttcacatatgtcaatgcacaattttgaccg |
36719392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 63 - 127
Target Start/End: Original strand, 24093073 - 24093137
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttg |
127 |
Q |
| |
|
|||||| ||||||||||||||| |||| |||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
24093073 |
tactccatccgtttcaaaatacatgtcgtagtcaaccacttcacacatgtcaattcacaactttg |
24093137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 7800109 - 7800041
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||||| ||||||||||| |||| ||||||||||||||| ||| | |||||||| |||||||| |
|
|
| T |
7800109 |
tactccctccctttcaaaatacatgtcgttgtcaaccacttcacacatgcctatgcacaactttgaccg |
7800041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 63 - 131
Target Start/End: Complemental strand, 32774854 - 32774786
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||| ||| ||||||||||||| |||| |||||||||| || |||||| ||||||| ||| |||||||| |
|
|
| T |
32774854 |
tactaccttcgtttcaaaatacatgtccaagtcaaccattttacatatatcaatgcgcaactttgaccg |
32774786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 91 - 131
Target Start/End: Complemental strand, 39358369 - 39358329
Alignment:
| Q |
91 |
aagtcaaccacttcacatatgtcaatgcacaattttgaccg |
131 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
39358369 |
aagtcaactacttcacatatgccaatgcacaattttgaccg |
39358329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 94 - 129
Target Start/End: Complemental strand, 44645102 - 44645067
Alignment:
| Q |
94 |
tcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44645102 |
tcaaccacttcacatatgtcaatacacaattttgac |
44645067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 6223328 - 6223263
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
||||| |||||||| |||| || | || || |||||||||| ||||||||||||||| |||||||| |
|
|
| T |
6223328 |
tactctctccgttttaaaacacatatccaaatcaaccactttacatatgtcaatgcataattttga |
6223263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 92 - 128
Target Start/End: Original strand, 33228474 - 33228510
Alignment:
| Q |
92 |
agtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
33228474 |
agtcaaccacttcacacatgtcaatgcacaactttga |
33228510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0056 (Bit Score: 50; Significance: 9e-20; HSPs: 1)
Name: scaffold0056
Description:
Target: scaffold0056; HSP #1
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 63 - 128
Target Start/End: Complemental strand, 71222 - 71157
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttga |
128 |
Q |
| |
|
|||||| ||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
71222 |
tactccatccgtttcaaaatacatgtccaagtcaaccacttcacatatgccaatgcacaattttga |
71157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 70 - 129
Target Start/End: Original strand, 161844 - 161903
Alignment:
| Q |
70 |
tccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
161844 |
tccgtttcaaaatacatgttcaagtcaaccactttacatatgtcaatgcacaattttgac |
161903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0295 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 1)
Name: scaffold0295
Description:
Target: scaffold0295; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 63 - 129
Target Start/End: Original strand, 13717 - 13783
Alignment:
| Q |
63 |
tactccctccgtttcaaaatacttgtctaagtcaaccacttcacatatgtcaatgcacaattttgac |
129 |
Q |
| |
|
|||||| ||||||||||||||| ||| ||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
13717 |
tactccatccgtttcaaaatacatgttcaagtcaaccactttacatatgtcaatgcaaaattttgac |
13783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University