View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4647_low_37 (Length: 225)
Name: NF4647_low_37
Description: NF4647
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4647_low_37 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 16 - 204
Target Start/End: Original strand, 508160 - 508348
Alignment:
| Q |
16 |
atcaacgattacttgactagagcttaatacatattaatggtaacaattattcttgatattattaatgattgttgtgtcactctgtttcaaggaaaagtat |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
508160 |
atcaacgattacttgactagagcttaatacatattaatggtaacaattattcttgatattattaatgattgttgtgtcactctgttttaaggaaaagtat |
508259 |
T |
|
| Q |
116 |
gccttaaaatatgctgctcgtatggagtactttcacttataaacgaccgcatatatgtggcccttgtttgagatgcggacggtgttcat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
508260 |
gccttaaaatatgctgctcgtatggagtactttcacttataaacgaccgcatatatgtggcccttgtttgagatgcggacggtgttcat |
508348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 109 - 204
Target Start/End: Complemental strand, 547471 - 547376
Alignment:
| Q |
109 |
aaagtatgccttaaaatatgctgctcgtatggagtactttcacttataaacgaccgcatatatgtggcccttgtttgagatgcggacggtgttcat |
204 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||| || |||||||| ||||| ||| |||| ||||||| ||| |||||||| ||||||||| |
|
|
| T |
547471 |
aaagtatgccttaaaatatgccgttcgtatggagtacctttgcttataaatgaccgtatagatgtagcccttgcttgtgatgcggatggtgttcat |
547376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University