View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4648-Insertion-11 (Length: 230)
Name: NF4648-Insertion-11
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4648-Insertion-11 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 149 - 230
Target Start/End: Complemental strand, 9203915 - 9203834
Alignment:
| Q |
149 |
agatcatatatataaatttttacgtaaattaaaatcatttgatatattttcgagactcgtcaagattaaggtcgtttatgca |
230 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9203915 |
agatcacatatataaatttttacgtaaattaaaatcatttgatatgttttcgagactcgtcaagattaaggtcatttatgca |
9203834 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 9204031 - 9203978
Alignment:
| Q |
34 |
gttgaaatatgaaattatacta-tgtaatgttacatcattgttatactgcttaa |
86 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
9204031 |
gttgaaatatgaaattatactaatgtaatgttacatcattgttatactgcttaa |
9203978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University