View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4648-Insertion-11 (Length: 230)

Name: NF4648-Insertion-11
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4648-Insertion-11
NF4648-Insertion-11
[»] chr8 (2 HSPs)
chr8 (149-230)||(9203834-9203915)
chr8 (34-86)||(9203978-9204031)


Alignment Details
Target: chr8 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 149 - 230
Target Start/End: Complemental strand, 9203915 - 9203834
Alignment:
149 agatcatatatataaatttttacgtaaattaaaatcatttgatatattttcgagactcgtcaagattaaggtcgtttatgca 230  Q
    |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||    
9203915 agatcacatatataaatttttacgtaaattaaaatcatttgatatgttttcgagactcgtcaagattaaggtcatttatgca 9203834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 34 - 86
Target Start/End: Complemental strand, 9204031 - 9203978
Alignment:
34 gttgaaatatgaaattatacta-tgtaatgttacatcattgttatactgcttaa 86  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||    
9204031 gttgaaatatgaaattatactaatgtaatgttacatcattgttatactgcttaa 9203978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University