View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4648_high_21 (Length: 205)
Name: NF4648_high_21
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4648_high_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 32701949 - 32702020
Alignment:
| Q |
102 |
ggggtttaaccgccgaacccacgccacccattaaccaaaaagcttcttccttccttccatgaatcaagccatg |
174 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32701949 |
ggggtttaaccgccgaacccacgcc-cccattaaccaaaaagcttcttccttccttccatgaatcaagccatg |
32702020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University