View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4648_high_21 (Length: 205)

Name: NF4648_high_21
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4648_high_21
NF4648_high_21
[»] chr3 (1 HSPs)
chr3 (102-174)||(32701949-32702020)


Alignment Details
Target: chr3 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 32701949 - 32702020
Alignment:
102 ggggtttaaccgccgaacccacgccacccattaaccaaaaagcttcttccttccttccatgaatcaagccatg 174  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
32701949 ggggtttaaccgccgaacccacgcc-cccattaaccaaaaagcttcttccttccttccatgaatcaagccatg 32702020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University