View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4648_high_3 (Length: 509)
Name: NF4648_high_3
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4648_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 153; Significance: 7e-81; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 11 - 171
Target Start/End: Complemental strand, 41787540 - 41787380
Alignment:
| Q |
11 |
cataggactagttgcaaatgcatgtggctctacagtaacttcagtatgtccattcttgaggaagaatcatatcattctggacttctgttgctgcttttgt |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787540 |
cataggactagttgcaaatgcatgtggctctacagtaacttcaatatgtccattcttgaggaagaatcatatcattctggacttctgttgctgcttttgt |
41787441 |
T |
|
| Q |
111 |
tgactggtgattctcaagtgaaaacataccttccctatggttcaaaacaatatctgcaaat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
41787440 |
tgactggtgattctcaagtgaaaacataccttccctatggttcaaaacaagatctgcaaat |
41787380 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 172 - 348
Target Start/End: Complemental strand, 41787356 - 41787184
Alignment:
| Q |
172 |
agcaaattgattcacaaaaaatagatgaaaatcaaattagatagttttatattcataatcaataactgtcagttcaatactatagaactagttggcgaca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41787356 |
agcaaattgattcacaaaaaatagatgaaaatcaaattagatagttttatattcataatcaataactgtcagttcaatactatagaactagttggcgaca |
41787257 |
T |
|
| Q |
272 |
aattgctagttgatagcaccaagtatttggactgttggaataaattgcatgcagcagtatcgaaaagcaaaattgga |
348 |
Q |
| |
|
|||||||||||||||| ||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41787256 |
aattgctagttgatagtaccaagtatttggaccgttggaataaat----tgcagcagtatcgaaaagcaaaattgga |
41787184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 459 - 492
Target Start/End: Complemental strand, 41786825 - 41786792
Alignment:
| Q |
459 |
aacatgacgtatgccaatttatgaaagtataaac |
492 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41786825 |
aacatgacgtatgccaatttatgaaagtataaac |
41786792 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 373 - 401
Target Start/End: Complemental strand, 41787180 - 41787152
Alignment:
| Q |
373 |
aattaatcatagagattagtactaactac |
401 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41787180 |
aattaatcatagagattagtactaactac |
41787152 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University