View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4648_low_12 (Length: 280)
Name: NF4648_low_12
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4648_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 68 - 262
Target Start/End: Complemental strand, 35118 - 34922
Alignment:
| Q |
68 |
ttaatcattttcgttctcagaatgttatttttat--gtgttatttgggggaggtaaggtaaggtgaaattagggtttcgttgttgtatttggggaagnnn |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35118 |
ttaatcattttcgttctcagaatgttatttttatttgtgttatttgggggaggtaaggtaaggtgaaattagggtttcgttgttgtatttggggaagaaa |
35019 |
T |
 |
| Q |
166 |
nnnnnnnctaaaccctaattttacaaatggtgtgtgcaggctgtgagatggatttgtgcgaatctcctccaaaggctaaggaaaaagattgtgttgt |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
35018 |
aaaaaaactaaaccctaattttacaaatggtgtgtgcaggctgtgagatggatttgtgcgaatctcctccgaaggctaaggaaaaagattgtgttgt |
34922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University