View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4648_low_16 (Length: 239)
Name: NF4648_low_16
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4648_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 19 - 226
Target Start/End: Original strand, 55577885 - 55578092
Alignment:
| Q |
19 |
gaaatacccctcagctatgacagacaaaatactggataggatggacgactttcagcaaagggttgggattttggatcaccatcgtgatccatactggcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55577885 |
gaaatacccctcagctatgacagacaaaatactggataggatggacgactttcagcaaagggttgggattttggatcaccatcgtgatccatactggcat |
55577984 |
T |
|
| Q |
119 |
tgaacacaagattgtggccttgcataaaactatagtactgcttagcttcttttcttttcaatctggggtttattactttgttttggactagtttatgatg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55577985 |
tgaacacaagattgtggccttgcataaaactatagtactgcttagcttcttttcttttcaatttggggtttattactttgttttggactagtttatgatg |
55578084 |
T |
|
| Q |
219 |
ttaatctc |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
55578085 |
ttaatctc |
55578092 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 169 - 223
Target Start/End: Original strand, 21256948 - 21257002
Alignment:
| Q |
169 |
tttcttttcaatctggggtttattactttgttttggactagtttatgatgttaat |
223 |
Q |
| |
|
|||||||||||| ||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
21256948 |
tttcttttcaatttggtgtttattactttattttggactagtttatgattttaat |
21257002 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University