View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4648_low_3 (Length: 509)

Name: NF4648_low_3
Description: NF4648
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4648_low_3
NF4648_low_3
[»] chr2 (4 HSPs)
chr2 (11-171)||(41787380-41787540)
chr2 (172-348)||(41787184-41787356)
chr2 (459-492)||(41786792-41786825)
chr2 (373-401)||(41787152-41787180)


Alignment Details
Target: chr2 (Bit Score: 153; Significance: 7e-81; HSPs: 4)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 153; E-Value: 7e-81
Query Start/End: Original strand, 11 - 171
Target Start/End: Complemental strand, 41787540 - 41787380
Alignment:
11 cataggactagttgcaaatgcatgtggctctacagtaacttcagtatgtccattcttgaggaagaatcatatcattctggacttctgttgctgcttttgt 110  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41787540 cataggactagttgcaaatgcatgtggctctacagtaacttcaatatgtccattcttgaggaagaatcatatcattctggacttctgttgctgcttttgt 41787441  T
111 tgactggtgattctcaagtgaaaacataccttccctatggttcaaaacaatatctgcaaat 171  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
41787440 tgactggtgattctcaagtgaaaacataccttccctatggttcaaaacaagatctgcaaat 41787380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 152; E-Value: 3e-80
Query Start/End: Original strand, 172 - 348
Target Start/End: Complemental strand, 41787356 - 41787184
Alignment:
172 agcaaattgattcacaaaaaatagatgaaaatcaaattagatagttttatattcataatcaataactgtcagttcaatactatagaactagttggcgaca 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41787356 agcaaattgattcacaaaaaatagatgaaaatcaaattagatagttttatattcataatcaataactgtcagttcaatactatagaactagttggcgaca 41787257  T
272 aattgctagttgatagcaccaagtatttggactgttggaataaattgcatgcagcagtatcgaaaagcaaaattgga 348  Q
    |||||||||||||||| ||||||||||||||| ||||||||||||    ||||||||||||||||||||||||||||    
41787256 aattgctagttgatagtaccaagtatttggaccgttggaataaat----tgcagcagtatcgaaaagcaaaattgga 41787184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 459 - 492
Target Start/End: Complemental strand, 41786825 - 41786792
Alignment:
459 aacatgacgtatgccaatttatgaaagtataaac 492  Q
    ||||||||||||||||||||||||||||||||||    
41786825 aacatgacgtatgccaatttatgaaagtataaac 41786792  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 373 - 401
Target Start/End: Complemental strand, 41787180 - 41787152
Alignment:
373 aattaatcatagagattagtactaactac 401  Q
    |||||||||||||||||||||||||||||    
41787180 aattaatcatagagattagtactaactac 41787152  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University