View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4649-Insertion-8 (Length: 147)
Name: NF4649-Insertion-8
Description: NF4649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4649-Insertion-8 |
 | |
|
| [»] chr8 (2 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 6e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 6e-60
Query Start/End: Original strand, 7 - 147
Target Start/End: Original strand, 7937087 - 7937227
Alignment:
| Q |
7 |
ataaaggagtgggagtagtagtaaatgatgatgatgttgtgaagtgaagagagaaacacgtgcatggcccactgtttagtaacagt--acacagctaaga |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
7937087 |
ataaaggagtgggagtagtagtaaatgatgatgatgttgtgaagtgaagagagaaacacgtgcatggcccactgtttagtaacggtacacacagctaaga |
7937186 |
T |
|
| Q |
105 |
atgatagtatatttttggtggagaaatggaaaattagttgtta |
147 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7937187 |
atg--agtatatttttggtggagaaatggaaaattagttgtta |
7937227 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.0000000008
Query Start/End: Original strand, 35 - 83
Target Start/End: Original strand, 7953053 - 7953101
Alignment:
| Q |
35 |
tgatgatgttgtgaagtgaagagagaaacacgtgcatggcccactgttt |
83 |
Q |
| |
|
|||||||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
7953053 |
tgatgatgatgtgaagtgaagggcaaaacacgtgcatggcccactgttt |
7953101 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University