View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4649-Insertion-9 (Length: 70)
Name: NF4649-Insertion-9
Description: NF4649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4649-Insertion-9 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 35; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000002
Query Start/End: Original strand, 8 - 42
Target Start/End: Complemental strand, 53275988 - 53275954
Alignment:
| Q |
8 |
attattatcaatcatatcctattatcctcgaacta |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
53275988 |
attattatcaatcatatcctattatcctcgaacta |
53275954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University