View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4649_low_4 (Length: 310)
Name: NF4649_low_4
Description: NF4649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4649_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 22 - 296
Target Start/End: Original strand, 41675088 - 41675362
Alignment:
| Q |
22 |
tgcctctgcctctgcctctggtatctattcctttccttttcattccctattttctaaattcttactatcttcgtatgcattattaccatcttctacttca |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41675088 |
tgcctctgcctctgcctctggtatctattcctttccttttcattccctattttctaaattcttactatcttcatatgcattattaccatcttctacttca |
41675187 |
T |
 |
| Q |
122 |
aattcttttgctaggcttattcaattcccctattcaatagccaagtttttattatgttaatgttttctcctgctc-tttaagtatatgtttgtatgtgag |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
41675188 |
aattcttttgctaggcttattcaattcccctattcaatatccaag-ttttattatgttaatgttttctcctgctcttttaagtgtatgtttgtatgtgag |
41675286 |
T |
 |
| Q |
221 |
gtaggtttcgcaaccatcatttttgttcaaccttcaaactatagcttttaccaaacttgttgtggctcactatgat |
296 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41675287 |
gtaggtttcccaaccatcatttttgttcaaccttcaaactatagcttttaccaaacttgttgtggctcactatgat |
41675362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University