View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4649_low_7 (Length: 251)
Name: NF4649_low_7
Description: NF4649
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4649_low_7 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 10 - 251
Target Start/End: Complemental strand, 30784263 - 30784022
Alignment:
| Q |
10 |
attattctatgctattattggaatttttggggggaatatggttttttaaaagtgtgtttttatctcatattagctttcaaataattgaaggttattgata |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784263 |
attattctatgctattattggaatttttggggggagtatggtttttaaaaagtgtgtttttatctcatattagctttcaaataattgaaggttattgata |
30784164 |
T |
|
| Q |
110 |
tgactggtgattaattaactaattgatagttatgttaattagttataggcagattatggacatagaactgattttggatttcaactgacttatataaaaa |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784163 |
tgactggtgattaattaactaattgatagttatgttaattagttataggcagattattgacatagaactgattttggatttcaactgacttatataaaaa |
30784064 |
T |
|
| Q |
210 |
tactataggagcgtaggggttagagagaaagaagagaatagc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30784063 |
tactataggagcgtaggggttagagagaaagaagagaatagc |
30784022 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University