View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4650-Insertion-8 (Length: 302)
Name: NF4650-Insertion-8
Description: NF4650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4650-Insertion-8 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 271; Significance: 1e-151; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 271; E-Value: 1e-151
Query Start/End: Original strand, 28 - 302
Target Start/End: Original strand, 46843585 - 46843859
Alignment:
| Q |
28 |
cagtgaagtgaattcaaaaccagagaacaaaactgttctgtttggatctcagttgaggattcagattcctccctttttaccaacaatttcaactttttct |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843585 |
cagtgaagtgaattcaaaaccagagaacaaaactgttctgtttggatctcagttgaagattcagattcctccctttttaccaacaatttcaactttttct |
46843684 |
T |
 |
| Q |
128 |
tcttcatctgaatcatcacctttatctagaggtgatttcagcatcaacacaagaaattctcatttgggttcttcttctggaagcttttcactctctcctg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843685 |
tcttcatctgaatcatcacctttatctagaggtgatttcagcatcaacacaagaaattctcatttgggttcttcttctggaagcttttcactctctcctg |
46843784 |
T |
 |
| Q |
228 |
tgggaaaatcttcatttgggtgtgctaatgaaattgaaacttcaaattctactcatggagtcttcaaagggtgtc |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46843785 |
tgggaaaatcttcatttgggtgtgctaatgaaattgaaacttcaaattctactcatggagtcttcaaagggtgtc |
46843859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University