View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4650_high_5 (Length: 246)

Name: NF4650_high_5
Description: NF4650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4650_high_5
NF4650_high_5
[»] chr4 (1 HSPs)
chr4 (28-223)||(46462010-46462208)


Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 28 - 223
Target Start/End: Complemental strand, 46462208 - 46462010
Alignment:
28 cataggtcataaattatttgctcagtataaatttaaaaatgatagttccaacaaatttaggctcaagaaatgcggaagcaagaagaagaaatagagagaa 127  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
46462208 cataggtcataaattatttgctcagtataaatttaaaaatgatagttccaacaaatttaggctcaagaaatgcggaagcaagaagaagaaatagagagaa 46462109  T
128 tccagttcatattgcagagccctgctcagcttcagcaatatggggctgaaactcaag---gtgttaatggcaatgttctctgtcccataaacaatgctc 223  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||   |||||||||||| ||||||||||||||||||||||||||    
46462108 tccagttcatattgcagagccctgctcagcttcagcaatatggggctgaaactcaagaaagtgttaatggcattgttctctgtcccataaacaatgctc 46462010  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University