View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4650_low_10 (Length: 227)
Name: NF4650_low_10
Description: NF4650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4650_low_10 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 80 - 227
Target Start/End: Original strand, 31048655 - 31048802
Alignment:
| Q |
80 |
gaaccgataatcctatgtagtaaattcgatgacaaagaggtaaggggggctatatacaacgtgtggaaaatattctttgctttacaactgcagcatcnnn |
179 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
31048655 |
gaaccgatcatcctatgtagtaaattcgatgacaaagaggtaaggggggctatatacaacgtgtagaaaatattctttgctttacaactgcagcatcttt |
31048754 |
T |
|
| Q |
180 |
nnnnggtgtgcctagtccctcgtactagcttcgtagggcattgcacta |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31048755 |
ttttggtgtgcctagtccctcgtactagcttcgtagggcattgcacta |
31048802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 7 - 56
Target Start/End: Original strand, 31048582 - 31048631
Alignment:
| Q |
7 |
ctagaatctccccctctttagtcaggtgactactagtttagtatggaatg |
56 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31048582 |
ctagaatctccacctctttagtcaggtgactactagtttagtatggaatg |
31048631 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University