View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4650_low_6 (Length: 246)
Name: NF4650_low_6
Description: NF4650
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4650_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 28 - 223
Target Start/End: Complemental strand, 46462208 - 46462010
Alignment:
| Q |
28 |
cataggtcataaattatttgctcagtataaatttaaaaatgatagttccaacaaatttaggctcaagaaatgcggaagcaagaagaagaaatagagagaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46462208 |
cataggtcataaattatttgctcagtataaatttaaaaatgatagttccaacaaatttaggctcaagaaatgcggaagcaagaagaagaaatagagagaa |
46462109 |
T |
 |
| Q |
128 |
tccagttcatattgcagagccctgctcagcttcagcaatatggggctgaaactcaag---gtgttaatggcaatgttctctgtcccataaacaatgctc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
46462108 |
tccagttcatattgcagagccctgctcagcttcagcaatatggggctgaaactcaagaaagtgttaatggcattgttctctgtcccataaacaatgctc |
46462010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University