View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4651-Insertion-11 (Length: 143)
Name: NF4651-Insertion-11
Description: NF4651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4651-Insertion-11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 129; Significance: 4e-67; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 140
Target Start/End: Complemental strand, 554144 - 554012
Alignment:
| Q |
8 |
atttttactttcctgatgaatgttgggaatttgtcttcaaattcctcatcaacgatggtaatagcgatggcaacaaccgtttgtacttgagatgtctctc |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
554144 |
atttttactttcctgatgaatgttgggaatttgtcttcaaattcctcatcaactatggtaatagcgatggcaacaaccgtttgtacttgagatgtctctc |
554045 |
T |
|
| Q |
108 |
ctttgtctctaaacagttcttatccatcaccaa |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
554044 |
ctttgtctctaaacagttcttatccatcaccaa |
554012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 2e-16
Query Start/End: Original strand, 8 - 83
Target Start/End: Complemental strand, 1546249 - 1546174
Alignment:
| Q |
8 |
atttttactttcctgatgaatgttgggaatttgtcttcaaattcctcatcaacgatggtaatagcgatggcaacaa |
83 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||||||||||||||||||||||| |||||| | |||||||| |
|
|
| T |
1546249 |
atttttactttctcgacgagtgttgggaatttgtcttcaaattcctcatcaacgatgtcaatagccacggcaacaa |
1546174 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000003
Query Start/End: Original strand, 10 - 62
Target Start/End: Original strand, 1523994 - 1524046
Alignment:
| Q |
10 |
ttttactttcctgatgaatgttgggaatttgtcttcaaattcctcatcaacga |
62 |
Q |
| |
|
|||||||| |||||||| |||||||||| ||||||||||||| |||||||||| |
|
|
| T |
1523994 |
ttttacttacctgatgactgttgggaatctgtcttcaaattcgtcatcaacga |
1524046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 61
Target Start/End: Complemental strand, 7978236 - 7978198
Alignment:
| Q |
23 |
atgaatgttgggaatttgtcttcaaattcctcatcaacg |
61 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
7978236 |
atgagtgttgggaatttgtcttcaaattccttatcaacg |
7978198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000002
Query Start/End: Original strand, 19 - 55
Target Start/End: Original strand, 51120336 - 51120372
Alignment:
| Q |
19 |
cctgatgaatgttgggaatttgtcttcaaattcctca |
55 |
Q |
| |
|
|||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
51120336 |
cctgatgactgttgggaatgtgtcttcaaattcctca |
51120372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 28; Significance: 0.0000007; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 8 - 55
Target Start/End: Complemental strand, 9412497 - 9412450
Alignment:
| Q |
8 |
atttttactttcctgatgaatgttgggaatttgtcttcaaattcctca |
55 |
Q |
| |
|
||||||| || |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
9412497 |
atttttatttacctgatgaatgttgggaaagtatcttcaaattcctca |
9412450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University