View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4651-Insertion-7 (Length: 411)
Name: NF4651-Insertion-7
Description: NF4651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4651-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 8 - 226
Target Start/End: Complemental strand, 24149711 - 24149495
Alignment:
| Q |
8 |
aataatattaagagaactattgttgctgcatggtagtattcaatcgagggtagtaataattttgtctaaagtattgtcttcttggtgaatcctgccacca |
107 |
Q |
| |
|
|||||||||| ||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24149711 |
aataatatta-gagcactattgtggctgcatggtagtattcgatcgagggtagtaataattttgtctaaagtattgtcttcttggtgaatcctgccacca |
24149613 |
T |
|
| Q |
108 |
caacttttatatgattcatcagttgatgattattgtcgttccaaataactcaatggaacgtatgtctcttcattgtaacactttatgatcttttgatgaa |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24149612 |
caacttttatatgattcatcagttgatgattattgtcg-tccaaataactcaatggaatgtatgtctcttcattgtaacactttatgatcttttgatgaa |
24149514 |
T |
|
| Q |
208 |
attaaattttcattgcaat |
226 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24149513 |
attaaattttcattgcaat |
24149495 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 343 - 411
Target Start/End: Complemental strand, 41621794 - 41621728
Alignment:
| Q |
343 |
atttggggttagcctactggttggcttgaggtcttggagagtttgtccctctcaaagtctcatatttga |
411 |
Q |
| |
|
|||||||||| ||||| ||||||||||||| ||||| ||||||| |||||||| ||||||| ||||| |
|
|
| T |
41621794 |
atttggggttggcctaatggttggcttgagatcttg--gagtttgctcctctcaaggtctcatgtttga |
41621728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University