View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4651_low_7 (Length: 259)
Name: NF4651_low_7
Description: NF4651
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4651_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 58 - 249
Target Start/End: Original strand, 35980588 - 35980779
Alignment:
| Q |
58 |
ccttaatttcttcttgataaagtatatgaatgtgcacaagagtgaattgcggggcaaatcttctttggcagtgagtttgtttgcatcatctgaatgatca |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35980588 |
ccttaatttcttcttgataaagtatatgaatgtgcacaagagtgaattgcggggcaaatcttctttggcagtgagtttgtttgcatcatctgaaagatca |
35980687 |
T |
|
| Q |
158 |
agtgaactactgccaaaaaagtcattgcccagtaatgcacttacacatgagtactatactccttaacaagctttattgtatggttgatgatg |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
35980688 |
agtgaactactgccaaaaaagtcattgcccagtaatgcacttacacatgagtactatactccttaacaagctttattgattggttgatgatg |
35980779 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 97 - 210
Target Start/End: Original strand, 35991381 - 35991494
Alignment:
| Q |
97 |
gagtgaattgcggggcaaatcttctttggcagtgagtttgtttgcatcatctgaatgatcaagtgaactactgccaaaaaagtcattgcccagtaatgca |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
35991381 |
gagtgaattgcggggcaaatcttctttggcggtgagtttgtttgcatcatctgaatgatcaagtcaactactgccaaagaagtcattgcccagtaatgca |
35991480 |
T |
|
| Q |
197 |
cttacacatgagta |
210 |
Q |
| |
|
| |||||||||||| |
|
|
| T |
35991481 |
cctacacatgagta |
35991494 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 95 - 127
Target Start/End: Complemental strand, 4985047 - 4985015
Alignment:
| Q |
95 |
aagagtgaattgcggggcaaatcttctttggca |
127 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
4985047 |
aagagtgaattgcggggaaaatcttctttggca |
4985015 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University