View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4652-Insertion-11 (Length: 180)
Name: NF4652-Insertion-11
Description: NF4652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4652-Insertion-11 |
 | |
|
| [»] scaffold0051 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0051 (Bit Score: 107; Significance: 7e-54; HSPs: 1)
Name: scaffold0051
Description:
Target: scaffold0051; HSP #1
Raw Score: 107; E-Value: 7e-54
Query Start/End: Original strand, 15 - 180
Target Start/End: Original strand, 10035 - 10200
Alignment:
| Q |
15 |
ggtgagaggccgcaagaatttcattagtgtaaaaactcaaattaggtttttcaattcttc-tatattgaaaaagcttatattaggttaatctaccactaa |
113 |
Q |
| |
|
||||||||||||||||| ||| || | ||||||||||||||||||||||||||||||| | |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10035 |
ggtgagaggccgcaagagtttgataa-tgtaaaaactcaaattaggtttttcaattctccctatatttaaaaagcttatattaggttaatctaccactaa |
10133 |
T |
|
| Q |
114 |
accctatctctagtgcacaaaattactaaaaagtcctaggtgnnnnnnnnaattaatccctaggtga |
180 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10134 |
accctatctctagtgcacaaaattactaaaaagtcctaggtgttttttttaattaatccctaggtga |
10200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University