View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4652-Insertion-16 (Length: 125)
Name: NF4652-Insertion-16
Description: NF4652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4652-Insertion-16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 1e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 1e-54
Query Start/End: Original strand, 8 - 119
Target Start/End: Complemental strand, 23195972 - 23195861
Alignment:
| Q |
8 |
gaattattggaagaggacggttagattgataaagctaggtgataaagtacacattggattcaattattttcaatatcatgtctgtacttcaccaaaccaa |
107 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23195972 |
gaattattggaagaggacgattagattgataaagctaggtgataaagtacacattggattcaattattttcaatatcatgtctgtacttcaccaaaccaa |
23195873 |
T |
|
| Q |
108 |
atataggaccac |
119 |
Q |
| |
|
|||||||||||| |
|
|
| T |
23195872 |
atataggaccac |
23195861 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University