View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4652_high_11 (Length: 250)
Name: NF4652_high_11
Description: NF4652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4652_high_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 218
Target Start/End: Original strand, 48137812 - 48138018
Alignment:
| Q |
12 |
agagattgaagggattggtatttctaactcgcatatcattccttttggaaatggcatgcaaaataaggaagttcaccaagaaaattattagagacccatg |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48137812 |
agagattgaagggattggtatttctaactcgcatatcattccttttggaaatggcatgcaaaataaggaagttcaccaagaaaattattagagacccatg |
48137911 |
T |
 |
| Q |
112 |
cgaccacatgtggaaattgctagatataccagtgattatggcttagaacttccaaatatgtggagctctttaatcacatgagatcgagatcaattgctta |
211 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48137912 |
cgaccacatgtggaaattgctagatatacgagtgattatggcttagaactttcaaatatgtggagctctttaatcacatgagatcgagatcaattgctta |
48138011 |
T |
 |
| Q |
212 |
gtataaa |
218 |
Q |
| |
|
||||||| |
|
|
| T |
48138012 |
gtataaa |
48138018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 213 - 245
Target Start/End: Original strand, 48138198 - 48138230
Alignment:
| Q |
213 |
tataaaataatcataaaagcatcttctaacaat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48138198 |
tataaaataatcataaaagcatcttctaacaat |
48138230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 48; Significance: 2e-18; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 159 - 218
Target Start/End: Original strand, 25249891 - 25249950
Alignment:
| Q |
159 |
acttccaaatatgtggagctctttaatcacatgagatcgagatcaattgcttagtataaa |
218 |
Q |
| |
|
|||| ||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
25249891 |
actttcaaatatgtggagctctttaatcacattagatcgagattaattgcttagtataaa |
25249950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 213 - 245
Target Start/End: Original strand, 25250724 - 25250756
Alignment:
| Q |
213 |
tataaaataatcataaaagcatcttctaacaat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
25250724 |
tataaaataatcataaaagcatcttctaacaat |
25250756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 127 - 159
Target Start/End: Original strand, 25249832 - 25249864
Alignment:
| Q |
127 |
attgctagatataccagtgattatggcttagaa |
159 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
25249832 |
attgctggatataccagtgattatggcttagaa |
25249864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 72 - 157
Target Start/End: Complemental strand, 40935538 - 40935453
Alignment:
| Q |
72 |
aaataaggaagttcaccaagaaaattattagagacccatgcgaccacatgtggaaattgctagatataccagtgattatggcttag |
157 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||| ||||||||||||||||| | || || |||||||||| |
|
|
| T |
40935538 |
aaataaggaagttcatgaagaaaattagctgagacccatgcgaccacatatggaaattgctagatatgctagagactatggcttag |
40935453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University