View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4652_high_14 (Length: 237)
Name: NF4652_high_14
Description: NF4652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4652_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 17 - 219
Target Start/End: Original strand, 32376275 - 32376469
Alignment:
| Q |
17 |
atgaatacgaagggttgtttcaaaagcatcaaataaatgttaagtttgagcgattttcaagnnnnnnnggatcgatttgaggtttattttaaatcggttt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
32376275 |
atgaatacgaagggttgtttcaaaagcaccaaataaatgttaagtttgagtaattttcaagttttttttgatcgatttaaggtttattttaaatcagttt |
32376374 |
T |
 |
| Q |
117 |
aaatgccaatatcccatcacggcatcaccaataatctcctaaccagcccaagtaaccagagagactttataatcattgttacaacttacaactagtacta |
216 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32376375 |
aaatgccaatatcccatc--------accaataatctcctaaccagcccaagtaacgagagagactttataatcattgttacaacttacaactagtacta |
32376466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University