View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4652_low_11 (Length: 277)
Name: NF4652_low_11
Description: NF4652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4652_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 4 - 265
Target Start/End: Original strand, 25608804 - 25609085
Alignment:
| Q |
4 |
gatgacttactcgatactggtttccgcttcttgtttgatttttcaatatttgctatgtgctgtagatggtaggaagtttgcttcgctaacatattataca |
103 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25608804 |
gatgacttactcgatactgttttccgctgcttgtttgatttttcaatatttgctatgtgctgtagatggtaggaagtttgcttcgctaacatattataca |
25608903 |
T |
|
| Q |
104 |
aattctttctatgatttctgtccttgagtgtgtattcttaatcttggataccttcagattttctcatattaattgattaacttcccctttgagccctat- |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
25608904 |
aattctttctatgatttctgtccttgagtgtgtattcttaatcttggataccttcagattttctcatattaattgattaacttcccctttgagccctctc |
25609003 |
T |
|
| Q |
203 |
-------------------actttgtaagtcggtgagaaagatttcattcatatgactcagtcgcatatatggtgccattca |
265 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
25609004 |
ttaatctaaattgattttcactttgtaagtcagtgagaaagatttcattcatatcactcagtcgcatatatggtgccattca |
25609085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University