View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4652_low_20 (Length: 232)
Name: NF4652_low_20
Description: NF4652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4652_low_20 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 72 - 197
Target Start/End: Original strand, 25608620 - 25608745
Alignment:
| Q |
72 |
attcgtgttaggttgcatcccttcatatttgcttcttttgtgttggtttttgaaatatatacaaactcatagttattattatttgtgatgcatgatgatc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25608620 |
attcgtgttaggttgcatcccttcatatttgcttcttttgtgttggtttttgaaatatatacaaactcatagttattattatttgtgatgcatgatgatc |
25608719 |
T |
 |
| Q |
172 |
tggtggagtggagtggagggtattat |
197 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
25608720 |
tggtggagtggagtggagggtattat |
25608745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 14 - 75
Target Start/End: Original strand, 25607697 - 25607758
Alignment:
| Q |
14 |
tattcttctaaggtatgtatgttcttttcttttatcaaaattattatccttttgttgaattc |
75 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25607697 |
tattcttctaaggtatgtatgttcttttcttttatcaaaattattatgcttttgttgaattc |
25607758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 14 - 70
Target Start/End: Original strand, 25608740 - 25608796
Alignment:
| Q |
14 |
tattcttctaaggtatgtatgttcttttcttttatcaaaattattatccttttgttg |
70 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||| |||||||||||||| ||||| |
|
|
| T |
25608740 |
tattattctaaggtatgtgtgttcttttcttttatctaaattattatccttctgttg |
25608796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 192 - 232
Target Start/End: Original strand, 25608781 - 25608821
Alignment:
| Q |
192 |
tattatccttctgttgtactctcgatgacttactcgatact |
232 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
25608781 |
tattatccttctgttgtactcatgatgacttactcgatact |
25608821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University