View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4652_low_6 (Length: 294)

Name: NF4652_low_6
Description: NF4652
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4652_low_6
NF4652_low_6
[»] chr8 (3 HSPs)
chr8 (1-275)||(4236387-4236670)
chr8 (126-165)||(37067887-37067926)
chr8 (126-164)||(37060411-37060449)
[»] chr6 (1 HSPs)
chr6 (1-153)||(6185611-6185763)
[»] chr7 (2 HSPs)
chr7 (126-165)||(402298-402337)
chr7 (177-239)||(45369930-45369992)


Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 4236670 - 4236387
Alignment:
1 agatggtggtaaaagacaatggtttaacattgttaggacttgtaggcattaaggatccatgtcgcccgggggtgaagacggcagtggaagcttgccaaca 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
4236670 agatggtggtaaaagacaatggtttaacattgttaggacttgtaggcattaaggatccatgtcgcccgggggtgaagacgacagtggaagcttgccaaca 4236571  T
101 tgctggtgtgaatgtcaaaatgattacaggtattactaaaatatcttatttatcgataacttgataatataaaattctctatttatacatacgagtctat 200  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
4236570 tgctggtgtgaatgtcaaaatgattacaggtattactaaaatatcttatttatcgataacttgataatataaaattctctatttatacatacgagcctat 4236471  T
201 atgaatacgaagaagataataagaa---------taactaattcttaattgactattaactaactttatctctgatgacaggtg 275  Q
    ||| | | || ||| ||||||||||         |||||| || |||||| || ||||||  ||||||||||||||||||||||    
4236470 atggaaatgatgaatataataagaatagttaacctaactagttgttaattaaccattaacatactttatctctgatgacaggtg 4236387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 126 - 165
Target Start/End: Original strand, 37067887 - 37067926
Alignment:
126 acaggtattactaaaatatcttatttatcgataacttgat 165  Q
    ||||||||||||||||||||| |||||| |||||||||||    
37067887 acaggtattactaaaatatctcatttattgataacttgat 37067926  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 164
Target Start/End: Original strand, 37060411 - 37060449
Alignment:
126 acaggtattactaaaatatcttatttatcgataacttga 164  Q
    ||||||||||||||||||||| |||||| ||||||||||    
37060411 acaggtattactaaaatatctcatttattgataacttga 37060449  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 153
Target Start/End: Complemental strand, 6185763 - 6185611
Alignment:
1 agatggtggtaaaagacaatggtttaacattgttaggacttgtaggcattaaggatccatgtcgcccgggggtgaagacggcagtggaagcttgccaaca 100  Q
    |||||||||||||||| |||| ||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| || |||||||||||||||||    
6185763 agatggtggtaaaagagaatgatttaacattgttaggacttgtcggcattaaggatccatgtcgcccaggggtgaagacagcggtggaagcttgccaaca 6185664  T
101 tgctggtgtgaatgtcaaaatgattacaggtattactaaaatatcttatttat 153  Q
    ||| |||||||||||||||||||||||||||||||||| ||||||| ||||||    
6185663 tgccggtgtgaatgtcaaaatgattacaggtattactataatatctcatttat 6185611  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 126 - 165
Target Start/End: Complemental strand, 402337 - 402298
Alignment:
126 acaggtattactaaaatatcttatttatcgataacttgat 165  Q
    ||||||||||||||||||||| ||||||||||||||||||    
402337 acaggtattactaaaatatctcatttatcgataacttgat 402298  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 177 - 239
Target Start/End: Original strand, 45369930 - 45369992
Alignment:
177 ctctatttatacatacgagtctatatgaatacgaagaagataataagaataactaattcttaa 239  Q
    ||||||||||||||| ||||| ||||||| | ||| | ||||| ||| |||||||||||||||    
45369930 ctctatttatacatatgagtccatatgaaaatgaaaaggataacaaggataactaattcttaa 45369992  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University