View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4653-Insertion-23 (Length: 161)

Name: NF4653-Insertion-23
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4653-Insertion-23
NF4653-Insertion-23
[»] chr4 (2 HSPs)
chr4 (10-161)||(1414728-1414879)
chr4 (8-84)||(1421125-1421200)


Alignment Details
Target: chr4 (Bit Score: 140; Significance: 1e-73; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 10 - 161
Target Start/End: Original strand, 1414728 - 1414879
Alignment:
10 gaacaaccccactttacacgatgtatataggggaagaactcctcttatggatggtctccttgatagttgatttaacaatcgaactataaccctggtggaa 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| ||||||    
1414728 gaacaaccccactttacacgatgtatataggggaagaactcctcttatggatggtctccttgatagtggatttaacaatcaaactataaccctcgtggaa 1414827  T
110 acgatactatacttactcttattacttgttagtgactatgtacacttgctca 161  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||    
1414828 acgatactatacttactcttattacttgttagtgactatgtacacttgctca 1414879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 1421125 - 1421200
Alignment:
8 atgaacaaccccactttacacgatgt-atataggggaagaactcctcttatggatggtctccttgatagttgatttaa 84  Q
    |||||||||||||||| ||| ||||| |||||||| |||||| ||| |||||||||||||||||| ||||||||||||    
1421125 atgaacaaccccacttaacatgatgttatataggg-aagaac-cctattatggatggtctccttgctagttgatttaa 1421200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University