View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653-Insertion-23 (Length: 161)
Name: NF4653-Insertion-23
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653-Insertion-23 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 140; Significance: 1e-73; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 140; E-Value: 1e-73
Query Start/End: Original strand, 10 - 161
Target Start/End: Original strand, 1414728 - 1414879
Alignment:
| Q |
10 |
gaacaaccccactttacacgatgtatataggggaagaactcctcttatggatggtctccttgatagttgatttaacaatcgaactataaccctggtggaa |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| |||||| |
|
|
| T |
1414728 |
gaacaaccccactttacacgatgtatataggggaagaactcctcttatggatggtctccttgatagtggatttaacaatcaaactataaccctcgtggaa |
1414827 |
T |
 |
| Q |
110 |
acgatactatacttactcttattacttgttagtgactatgtacacttgctca |
161 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1414828 |
acgatactatacttactcttattacttgttagtgactatgtacacttgctca |
1414879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000009
Query Start/End: Original strand, 8 - 84
Target Start/End: Original strand, 1421125 - 1421200
Alignment:
| Q |
8 |
atgaacaaccccactttacacgatgt-atataggggaagaactcctcttatggatggtctccttgatagttgatttaa |
84 |
Q |
| |
|
|||||||||||||||| ||| ||||| |||||||| |||||| ||| |||||||||||||||||| |||||||||||| |
|
|
| T |
1421125 |
atgaacaaccccacttaacatgatgttatataggg-aagaac-cctattatggatggtctccttgctagttgatttaa |
1421200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University