View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653-Insertion-24 (Length: 245)
Name: NF4653-Insertion-24
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653-Insertion-24 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 8 - 171
Target Start/End: Complemental strand, 43568642 - 43568473
Alignment:
| Q |
8 |
ggatgtagttgtgtcttgatttgaatttcgctagtgtttttacgtctttgaatgggatgaagtcttcttgggatttgggnnnnnnnngt------tgttg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |
|
|
| T |
43568642 |
ggatgtagttgtgtcttgatttgaatttcgctagtgtttttacgtctttgaatgggatgaagtcttcttgggatttgggttgtttttgttgttggtgttg |
43568543 |
T |
|
| Q |
102 |
gcattttggtttgtaagggaaagtgattcttgttgtcttgggtttgaattggagatgatgatgctgatag |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43568542 |
gcattttggtttgtaagggaaagtgattcttgttgtcttcggtttgaattggagatgatgatgctgatag |
43568473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 213 - 243
Target Start/End: Complemental strand, 43568437 - 43568407
Alignment:
| Q |
213 |
aagagagggagataggaccatccacattctt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
43568437 |
aagagagggagataggaccatccacattctt |
43568407 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University