View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_high_20 (Length: 243)
Name: NF4653_high_20
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 45 - 209
Target Start/End: Complemental strand, 18496765 - 18496600
Alignment:
| Q |
45 |
aaatatcaatattaagttatactattatttcatgatttattactattatctcttgagatttgattaatcattcagttcatgccttcgatttgggtaaatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||| | ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
18496765 |
aaatatcaatattaagttatactattatttcgtgatttattattattatctcttaggttttgatttatcattcagttcatgccttcgatttgggtaaatg |
18496666 |
T |
 |
| Q |
145 |
ttatgtatcttgttctattaagtctttcggttaaacaagtata-ttgaatttaaagagggttgtta |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
18496665 |
ttatgtatcttgttctattaactctttcggttaaacaagtgtagttgaatttaaagagggttgtta |
18496600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 45 - 209
Target Start/End: Complemental strand, 34200352 - 34200187
Alignment:
| Q |
45 |
aaatatcaatattaagttatactattatttcatgatttattactattatctcttgagatttgattaatcattcagttcatgccttcgatttgggtaaatg |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| ||||||||||| | ||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
34200352 |
aaatatcaatattaagttatactattatttcgtgatttattattattatctcttaggttttgatttatcattcagtacatgccttcgatttgggtaaata |
34200253 |
T |
 |
| Q |
145 |
ttatgtatcttgttctattaagtctttcggttaaacaagtata-ttgaatttaaagagggttgtta |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
34200252 |
ttatgtatcttgttctattaactctttcggttaaacaagtgtagttgaatttaaagagggttgtta |
34200187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University