View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_high_22 (Length: 239)
Name: NF4653_high_22
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 4 - 222
Target Start/End: Original strand, 52472000 - 52472218
Alignment:
| Q |
4 |
tgctttgtatttgctaacatgcagccaatttttagtgagtagaaataccatttaaactcttctatgtaccaaaccatgcgcaactgctccactaatgcat |
103 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52472000 |
tgctttgtattttctaccatgcagccaatttttagtgggtagaaataccatttaaactcttctatgtaccaaaccatgcgcaactgctccactaatgcat |
52472099 |
T |
 |
| Q |
104 |
caatgttcaaaatgatctgcttcatatataaatatacaagggatacttgagtcttcttgacacttcaccaacttgctattgtttcttaaattctttcttc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
52472100 |
caatgttcaaaatgatctgcttcatatataaatatacaagggatacttgagtcttcttgacacttcaccaacttgctattgattcttaaattctttcttc |
52472199 |
T |
 |
| Q |
204 |
tcccccaatatacgagaac |
222 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
52472200 |
tcccccaatatacgagaac |
52472218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University