View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_low_12 (Length: 306)
Name: NF4653_low_12
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_low_12 |
 | |
|
| [»] scaffold0707 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 206; Significance: 1e-112; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 206; E-Value: 1e-112
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 33575394 - 33575157
Alignment:
| Q |
1 |
gttccatgatttgcttacgcacctgaattgcgtgatggttttcacgctgaggaaacataggatgagggagatgagttcgttgggaatgaaaaccggcggc |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33575394 |
gttctatgatttgcttacgcacctgaattgcatgatggttttcacgctgaggaaacataggattagggagatgagttcgttgggaatgaacaccggcggc |
33575295 |
T |
|
| Q |
101 |
aatgccgtgttggattgaagatgttgcttcttaatcggagggatatcctccattggaacagtgaagacgttgaagttgaaaacgtgaaaccctaacacaa |
200 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33575294 |
aatggcgtgttggattgaagatgttgcttcttaatcggagggatatcctccattggagcagtgaagacgttgaagttgaaaacgtgaaaccctaacacaa |
33575195 |
T |
|
| Q |
201 |
agcgagctagaacaaatattggaaaagaaaaatcgcta |
238 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| |
|
|
| T |
33575194 |
agcgagcgagaacaaatattggacaagaaaaatcgcta |
33575157 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 33568091 - 33568044
Alignment:
| Q |
1 |
gttccatgatttgcttacgcacctgaattgcgtgatggttttcacgct |
48 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
33568091 |
gttccatgatttgcttacgcacttgaattgtgtgatggtcttcacgct |
33568044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 4485 - 4438
Alignment:
| Q |
1 |
gttccatgatttgcttacgcacctgaattgcgtgatggttttcacgct |
48 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |||||||| |
|
|
| T |
4485 |
gttccatgatttgcttacgcacttgaattgtgtgatggtcttcacgct |
4438 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University