View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_low_16 (Length: 270)
Name: NF4653_low_16
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 252; Significance: 1e-140; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 37111671 - 37111930
Alignment:
| Q |
1 |
ctttgattagaccggcgataactatgaagataatgacagccatgtgtaagagtgtggctatgtagttgaagatggaagagcctttggtgctgtaaactgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111671 |
ctttgattagaccggcgataactatgaagataatgacagccatgtgtaagagtgtggctatgtagttgaagatggaagagcctttggtgctgtaaactgc |
37111770 |
T |
|
| Q |
101 |
aagggctgttatggctactagagctgcaatagcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcagggttt |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37111771 |
aagggctgtgatggctactagagctgcaatagcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcagggttt |
37111870 |
T |
|
| Q |
201 |
ttgttgcagagggtggcaaaataggaggtccatgatcgagctactgcggcgttgcctatg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
37111871 |
ttgttgcagagggtggcaaaataggaggtccatgatcgagctaccgcggcgttgcctatg |
37111930 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 1 - 256
Target Start/End: Original strand, 37119926 - 37120181
Alignment:
| Q |
1 |
ctttgattagaccggcgataactatgaagataatgacagccatgtgtaagagtgtggctatgtagttgaagatggaagagcctttggtgctgtaaactgc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || | ||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37119926 |
ctttgattagaccggcgattactatgaagataatgacagccatgtggaacattgtggctatgtagttgaagatggaagaacctttggtgctgtaaactgc |
37120025 |
T |
|
| Q |
101 |
aagggctgttatggctactagagctgcaatagcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcagggttt |
200 |
Q |
| |
|
||| ||||| ||||||||||| ||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37120026 |
aagagctgtgatggctactagggctccaatagcaatagggtcaagatggccataatcaggattcatattgtgaactattatacgaaaatcatcagggttt |
37120125 |
T |
|
| Q |
201 |
ttgttgcagagggtggcaaaataggaggtccatgatcgagctactgcggcgttgcc |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
37120126 |
ttgttgcagagggtggcaaaataggaggtccatgatcgagctaccgccgcgttgcc |
37120181 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 86; E-Value: 4e-41
Query Start/End: Original strand, 131 - 244
Target Start/End: Complemental strand, 37136197 - 37136084
Alignment:
| Q |
131 |
agcaatagggtcaagatggccatagtcagggttcatattgtgaactattatacgaaaatcatcagggtttttgttgcagagggtggcaaaataggaggtc |
230 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| | ||||||||||||||| | ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37136197 |
agcaatagggtcaagatgaccataatcagggttcatattgtggaatattatacgaaaatcgttaggatttttgttgcagagggtggcaaaataggaggtc |
37136098 |
T |
|
| Q |
231 |
catgatcgagctac |
244 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37136097 |
catgatcgagctac |
37136084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University