View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_low_25 (Length: 238)
Name: NF4653_low_25
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_low_25 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 43488325 - 43488102
Alignment:
| Q |
1 |
aaagtcataccttttgatccgagtataaggttttttaggtctctctcccaatcactatcatagtttttattgaaggatcaagttgaaccgtgtgtgagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488325 |
aaagtcataccttttgatccgagtataaggttttttaggtctctctccctatcactatcatagtttttattgaaggatcaagttgaaccgtgtgtgagtt |
43488226 |
T |
|
| Q |
101 |
ctttgtctttctttttgatggagagggtttttaatactttgta-tttagtcagtggctttttcaatgtattttagatatttccaatcttataacagaaat |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43488225 |
ctttgtctttctttttgatggagagggtttttaatactttgtattttagtcagtggctttttcaatgtattttagatatttccaatcttataacagaaat |
43488126 |
T |
|
| Q |
200 |
aaaatttgcttcatgcattgatct |
223 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43488125 |
aaaatttgcttcatgcattgatct |
43488102 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University