View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_low_31 (Length: 225)
Name: NF4653_low_31
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_low_31 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 77 - 110
Target Start/End: Complemental strand, 11654818 - 11654785
Alignment:
| Q |
77 |
tgggttatgtgatgtagaagggctgttagttgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11654818 |
tgggttatgtgatgtagaagggctgttagttgat |
11654785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 77 - 110
Target Start/End: Complemental strand, 11668586 - 11668553
Alignment:
| Q |
77 |
tgggttatgtgatgtagaagggctgttagttgat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11668586 |
tgggttatgtgatgtagaagggctgttagttgat |
11668553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University