View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_low_33 (Length: 216)
Name: NF4653_low_33
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 19 - 128
Target Start/End: Complemental strand, 8431232 - 8431123
Alignment:
| Q |
19 |
aagttacgcaaggaagggaagtcaatattccataaatcaggaactaagtagagagagtctaagcaataagaatggattagaatcaatttatcgcaagtca |
118 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8431232 |
aagttacgcaaggaagggaaatcaatattccataaatcaggaactaggtagagagagtctaagcaataagaatggattagaatcaatttatcgcaagtca |
8431133 |
T |
 |
| Q |
119 |
ttacttttga |
128 |
Q |
| |
|
| |||||||| |
|
|
| T |
8431132 |
taacttttga |
8431123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University