View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4653_low_6 (Length: 378)
Name: NF4653_low_6
Description: NF4653
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4653_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 330; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 330; E-Value: 0
Query Start/End: Original strand, 7 - 360
Target Start/End: Complemental strand, 13087994 - 13087641
Alignment:
| Q |
7 |
ggagcagagagacgacaacgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactcatcaacatagaagatggtttgggaacaag |
106 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13087994 |
ggagcagtgagacgacaacgatcaatgataacactgaggttatagggtgcaacatctttggcaagccactgatcaacatagaagatggtttgggaacaag |
13087895 |
T |
 |
| Q |
107 |
gtttgtggggaccagtggaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087894 |
gtttgtggggaccagtggaggtgacctccacgtagtcgcagtaccacccatggtggtacccagatccgtctgaggcgaggttgaggcggcaaacacgtga |
13087795 |
T |
 |
| Q |
207 |
tttgatgcatggtccacgtccggtgaaggcatccacatttccgcgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13087794 |
gttgatgcatggtccacgtccggtgaaggcatccacatttccacgctcgaagtagttatgaccttctcccattgcaccccatgattttaggtttgggatc |
13087695 |
T |
 |
| Q |
307 |
catactgattggttctttgcatcgtcgaatctaatgctgatttttgaatctgtt |
360 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
13087694 |
cacactgattggttctttgcatcgtcgaatctaatgctgattttcgaatctgtt |
13087641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University