View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654-Insertion-16 (Length: 194)
Name: NF4654-Insertion-16
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654-Insertion-16 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 8 - 194
Target Start/End: Complemental strand, 25063827 - 25063643
Alignment:
| Q |
8 |
atccattcaatcagtgatgcacatttgagaaatagggataaaaagtgcctttagaatgtaaagtgcgcaattaatcattagttaacaaattaaaagcaga |
107 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25063827 |
atccattcaatcagtgctgcacatttgagaaatagggataaa--gtgcctttagaatgtaaagtgcgcaattaatcattagttaacaaattaaaagcaga |
25063730 |
T |
|
| Q |
108 |
tattataggtactacatagcaacaaaattgttctataggcttttcaaatttctctcagacacaagtaaatacccttttactcccaac |
194 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
25063729 |
tattataggtactacgtagcaagaaaattgttctataggcttttcaaatttctctcagacacaactaaatacccttttactcccaac |
25063643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University