View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654-Insertion-17 (Length: 281)
Name: NF4654-Insertion-17
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654-Insertion-17 |
 | |
|
| [»] chr4 (5 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 210; Significance: 1e-115; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 8 - 281
Target Start/End: Complemental strand, 34126048 - 34125776
Alignment:
| Q |
8 |
ctcttggcatgggaagacacaaggatgctggtgccttaactattcttgcccaagatgaggttgctggtcttgaagtgaagcatcaattttcacaagaatg |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
34126048 |
ctcttggcatgggaagacacaaggatgctggtgccttaactattcttgcccaagatgaggttgctggtcttgaagtgaagcatcaaatttcacaagaatg |
34125949 |
T |
|
| Q |
108 |
ggttcttgtgaaacccaccccaaatgctttcatcatcaacgttggtgatctcactcaggtacttttgccctaattcattatatttaannnnnnnnnnnna |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
34125948 |
ggttcttgtgaaacccaccccaaatgctttcatcatcaacgttggtgatctcactcaggtacttttgccctaattcattatattt-agttttttttttta |
34125850 |
T |
|
| Q |
208 |
tgctatttaggatacgcatgagttggccgactacaaaatatgttgttggaactaaaaacatatttaacctataa |
281 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
34125849 |
tgctacttaggatacgcatgagttggccgactacaaaatatattgttgggattaaaaacatatttaacctataa |
34125776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 23 - 172
Target Start/End: Complemental strand, 34131175 - 34131026
Alignment:
| Q |
23 |
gacacaaggatgctggtgccttaactattcttgcccaagatgaggttgctggtcttgaagtgaagcatcaattttcacaagaatgggttcttgtgaaacc |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| | ||| ||| ||||||||||||||||||| |
|
|
| T |
34131175 |
gacacaaggatgctggtgccttaactattcttgcccaagatgaggttggaggacttgaagtgaagcgtaaatcagaccaacaatgggttcttgtgaaacc |
34131076 |
T |
|
| Q |
123 |
caccccaaatgctttcatcatcaacgttggtgatctcactcaggtacttt |
172 |
Q |
| |
|
|||||| |||||| ||| ||||| ||||||||| ||| ||||||||||| |
|
|
| T |
34131075 |
taccccagatgcttacattatcaatgttggtgatatcattcaggtacttt |
34131026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 23 - 173
Target Start/End: Complemental strand, 34136866 - 34136716
Alignment:
| Q |
23 |
gacacaaggatgctggtgccttaactattcttgcccaagatgaggttgctggtcttgaagtgaagcatcaattttcacaagaatgggttcttgtgaaacc |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||| || |||||||| ||||||||||||||||| |
|
|
| T |
34136866 |
gacacaaggatgctggtgccttaactattcttgcccaagatgatgttgggggtcttgaagtgaagcacaaagcatcacaagagtgggttcttgtgaaacc |
34136767 |
T |
|
| Q |
123 |
caccccaaatgctttcatcatcaacgttggtgatctcactcaggtactttt |
173 |
Q |
| |
|
||| || |||||| ||| ||||||||| ||||| | | ||||||||||| |
|
|
| T |
34136766 |
tacctcagatgcttacattatcaacgtttgtgatattatccaggtactttt |
34136716 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 8 - 88
Target Start/End: Complemental strand, 34140039 - 34139959
Alignment:
| Q |
8 |
ctcttggcatgggaagacacaaggatgctggtgccttaactattcttgcccaagatgaggttgctggtcttgaagtgaagc |
88 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||| ||||||||| ||| | ||||||||| |||||||||||||||| |
|
|
| T |
34140039 |
ctcttggccttggaagacacaaggatgctggtgccttgactattcttaccctaaatgaggttgaaggtcttgaagtgaagc |
34139959 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 28 - 169
Target Start/End: Complemental strand, 34142665 - 34142524
Alignment:
| Q |
28 |
aaggatgctggtgccttaactattcttgcccaagatgaggttgctggtcttgaagtgaagcatcaattttcacaagaatgggttcttgtgaaacccaccc |
127 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||| || ||||||||||||| || ||| | |||||||||||||||||||| | |
|
|
| T |
34142665 |
aaggattctggtgccttaactattcttgcccaagatgaggttggaggacttgaagtgaagcggaaaacagatcaacagtgggttcttgtgaaacccacac |
34142566 |
T |
|
| Q |
128 |
caaatgctttcatcatcaacgttggtgatctcactcaggtac |
169 |
Q |
| |
|
|| |||||| || || || ||||||||| ||| |||||||| |
|
|
| T |
34142565 |
cagatgcttatattattaatgttggtgatgtcattcaggtac |
34142524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University