View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654-Insertion-23 (Length: 149)
Name: NF4654-Insertion-23
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654-Insertion-23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 2e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 53125755 - 53125655
Alignment:
| Q |
8 |
gtaccttcagctaaaggtttgtaatgtacatgccttcaccttcttttatgtttatttagatatgtttctcatgttggtcttcttcactatacacaattca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53125755 |
gtaccttcagctaaaggtttgtaatgtacatgccttcaccttcttttatgtttatttagatatgtttctcatgttggtcttcttcactatacacaattca |
53125656 |
T |
 |
| Q |
108 |
a |
108 |
Q |
| |
|
| |
|
|
| T |
53125655 |
a |
53125655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 53107965 - 53107919
Alignment:
| Q |
8 |
gtaccttcagctaaaggtttgtaatgtacatgccttcaccttctttt |
54 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||| ||| ||||||||| |
|
|
| T |
53107965 |
gtaccttcaactaaaggtttgtattgtacatgcattccccttctttt |
53107919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 53107906 - 53107863
Alignment:
| Q |
55 |
atgtttatttagatatgtttctcatgttggtcttcttcactata |
98 |
Q |
| |
|
|||||| |||| ||||||| ||||||||||||||||| |||||| |
|
|
| T |
53107906 |
atgtttgtttatatatgttgctcatgttggtcttcttaactata |
53107863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University