View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4654-Insertion-23 (Length: 149)

Name: NF4654-Insertion-23
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4654-Insertion-23
NF4654-Insertion-23
[»] chr4 (3 HSPs)
chr4 (8-108)||(53125655-53125755)
chr4 (8-54)||(53107919-53107965)
chr4 (55-98)||(53107863-53107906)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 2e-50; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 2e-50
Query Start/End: Original strand, 8 - 108
Target Start/End: Complemental strand, 53125755 - 53125655
Alignment:
8 gtaccttcagctaaaggtttgtaatgtacatgccttcaccttcttttatgtttatttagatatgtttctcatgttggtcttcttcactatacacaattca 107  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
53125755 gtaccttcagctaaaggtttgtaatgtacatgccttcaccttcttttatgtttatttagatatgtttctcatgttggtcttcttcactatacacaattca 53125656  T
108 a 108  Q
    |    
53125655 a 53125655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 31; E-Value: 0.00000001
Query Start/End: Original strand, 8 - 54
Target Start/End: Complemental strand, 53107965 - 53107919
Alignment:
8 gtaccttcagctaaaggtttgtaatgtacatgccttcaccttctttt 54  Q
    ||||||||| ||||||||||||| ||||||||| ||| |||||||||    
53107965 gtaccttcaactaaaggtttgtattgtacatgcattccccttctttt 53107919  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 55 - 98
Target Start/End: Complemental strand, 53107906 - 53107863
Alignment:
55 atgtttatttagatatgtttctcatgttggtcttcttcactata 98  Q
    |||||| |||| ||||||| ||||||||||||||||| ||||||    
53107906 atgtttgtttatatatgttgctcatgttggtcttcttaactata 53107863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University