View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_high_15 (Length: 270)
Name: NF4654_high_15
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_high_15 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 25948434 - 25948191
Alignment:
| Q |
18 |
ctagcaaattataacgtttgatttctaattggttttaacagtcacccttaaactaaagtttactatgctttatttaagcttgttacaaaacttttcacaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
25948434 |
ctagcaaattataacgtttgatttctaattggttttaacactcacccttaaactaaagtttactatgctttatttaagcttgttacaaaacttttcataa |
25948335 |
T |
|
| Q |
118 |
cataaaactcttaaaactaaatttgacaactattgggtagtgtgagccgtaaccgacataagttaccatctgtttatgttggttacaacccaccctaccc |
217 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
25948334 |
cttaaaactcttaaaactaaatttgacaactattgggtagtgtgagccgtaaccgacataagttaccctctgtttatgttggttacaacccaccctaccc |
25948235 |
T |
|
| Q |
218 |
caatagttgtcatatcaattacgctatgatttgctaggagcctt |
261 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25948234 |
caatagttgtcatatcaattacgctatgatttgctaggagcctt |
25948191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University