View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_high_20 (Length: 250)
Name: NF4654_high_20
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_high_20 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 15 - 244
Target Start/End: Original strand, 49585539 - 49585768
Alignment:
| Q |
15 |
agacccgtgtaagtagacggtagaattagacatcttaaattaatcgatccttttaccaatatcgagttttaataaaacaaaaccatggtttgtgattttc |
114 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49585539 |
agacccatgtaagtagacggtagaattagacatcttaaattaatcgatctttttaccaataacgagttttaataaaacaaaaccatggtttgtgattttc |
49585638 |
T |
 |
| Q |
115 |
cttaatcagggattaattaagttcccttctcttcaagtattgcatgttgccgcactccactaccactaaagagattctttttcaatgtagttgctactac |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49585639 |
cttaatcagggattaattaagttcccttctcttcaagtattgcatgttgccgcactccactaccactaaagagattctttttcaatgtagttgctactac |
49585738 |
T |
 |
| Q |
215 |
agcgcgtgtaacacaccgtgagaatatttt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
49585739 |
agcgcgtgtaacacaccgtgagaatatttt |
49585768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University