View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_high_25 (Length: 238)
Name: NF4654_high_25
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_high_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 25064048 - 25063822
Alignment:
| Q |
1 |
tatggttaaattattattaaagtttcctcttgaggattaagcctttcattgatttcca-taacatcaatttatttttcaagttttgacaacaaaattaag |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25064048 |
tatggttaaattattatttaagtttcctctttaggattaggcctttcattgatttccaataacatcaatttatttttcaagttttgacaacaaaattaag |
25063949 |
T |
 |
| Q |
100 |
tcaacttatttttatggacaatcattaat---aggatttacaaactctaatttcaaattggcttgaagagttgaattaatctgatagtgaatatttgcaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
25063948 |
tcaacttatttttatggacaatcattaatgataggatttacaaactctaatttcaaattggcttgaagagttgaattagtctgatagtgattatttgcaa |
25063849 |
T |
 |
| Q |
197 |
tcacttctgcaactactgcttatccat |
223 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
25063848 |
tcacttctgcaactactgcttatccat |
25063822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 161 - 220
Target Start/End: Original strand, 762295 - 762354
Alignment:
| Q |
161 |
gaagagttgaattaatctgatagtgaatatttgcaatcacttctgcaactactgcttatc |
220 |
Q |
| |
|
|||||||||||| | || |||||||||||||| ||||||||| ||||||||||| ||||| |
|
|
| T |
762295 |
gaagagttgaatgagtcagatagtgaatatttccaatcacttttgcaactactgtttatc |
762354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University