View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4654_high_26 (Length: 238)
Name: NF4654_high_26
Description: NF4654
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4654_high_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 16835942 - 16836163
Alignment:
| Q |
17 |
aagagtaagaatatttgtaacagtgaagacagtcagtatatgtcgacatagaatgcccgagtattcaaacattcgacagctacaatttgcctttgcccta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
16835942 |
aagagtaagaatatttgtaacagtgaagacagtcagtatatgtcgacatagaatgcccgagtattcaaacattcgacagctacaatttgcctttgcccca |
16836041 |
T |
 |
| Q |
117 |
gaaatatctaacggaacactgactgtgtatgcctcacgattatcttgaaagtttgcaaccctgtatttacagaccacaccgtcatcttcaattttatttg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
16836042 |
gaaatatctaacggaacactgactgtgtatgcctcacgattatcttgaaagtttgcaaccctgtatttacagatcacaccatcatcttcaattttatttg |
16836141 |
T |
 |
| Q |
217 |
cattataagcagaagttctcac |
238 |
Q |
| |
|
|| ||||||||||||||||||| |
|
|
| T |
16836142 |
cagtataagcagaagttctcac |
16836163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University